Fastest strstr-like Function!?


Fastest strstr-like Function!?

I've made a blend of the famous Karp-Rabin-Boyer-Moore-Horspool-Sunday algorithms named Railgun.
When a needle is needed to be found in a haystack here comes the Railgun_Quadruplet - an extremely fast pattern searcher designed both for short(2bytes) and long(gigabytes) patterns/strings, to be replaced by Railgun_r8_Mimino_x64 hopefully this year.
Railgun is free, however I expect the user to mention its homepage, that is, this very page.

My little/inconclusive test shows: the pair Railgun_Quadruplet_8Triplet/Railgun_Doublet is simply the fastest string searcher (mini-memmem) to my knowledge, gladly I will update this statement when a faster one is found/e-mailed. Mischa Sandberg showed that 'Railgun_Quadruplet' is slower than strstr: (Linux libc 2.6.32) which uses SSE 4.2, ssestr: using SSE2 instructions, winstr: a sliding 2..4-byte window algorithm. Many thanks go to Mischa for sharing the wonderful BNDM.

Railgun_Doublet outperforms definitely GNU/winstr/BNDM on 64bit platforms (at least for Windows).
Summary for strstr-like (i.e. memmem for short strings/patterns) usage:
- for 32bit use Railgun_Quadruplet_8Triplet
- for 64bit use Railgun_Doublet
My interest has been shifted from strstr toward memmem, Railgun_Doublet will fill the gap (short strings/patterns cases) in Railgun_r8_Mimino_x64 by covering mini-memmem whereas 'Trident'+'Hasherezade' will deal with maxi-memmem part, 'Hasherezade' should be surely tuned for 64bit.

Update: Last night (2012 Feb 25) achieved 13%-20% boost of my strstr-like (i.e. short strings/patterns cases) function compared to GNU's Berg's strstr function - both compiled as 64bit code using Microsoft 16 and Intel 12.1 compilers. For full benchmark see the commented lines further below. After some ups-and-downs experienced in Windows 7 64bit with Intel 12.1 64bit and Microsoft 16 64bit C compilers I revised Railgun in order to fit it better in the new environment which resulted in appearance of Railgun_Doublet. The function is tiny: with 00cc5-00c71+1+1 = 86 bytes main-loop.

Update: Last night (2012 Jan 26) achieved 3GB/s search speed on Pentium Merom 2166MHz with 3.2GB/s memory write for 10+ long patterns like 'fastest fox'. Revision 7Gulliver utilizes two chars (i.e. order 2) logic instead of one char, downloadable at bottom of this page.

Update: Last night (2012 Jan 22) revision 7sun made the r.7 obsolete due to faster BMH fragment, now BMS, downloadable at bottom of this page.

Update: Last night (2011 Sep 24) revision 7 made the r.6+++ obsolete due to faster BMH fragment, more tests are required on different CPUs to confirm the boost, though.

Update: Last night (2011 Sep 06) I found a bug only in r.6++, the line countSTATIC = cbPattern-2-3; becomes countSTATIC = cbPattern-2-2;, that is the fix. There is something important behind this fix, for more here.

Update: Pre-last night (2011 Sep 04) it took me 7-8 hours to tweak the revision 6+, which resulted in 6++ (downloadable at bottom of the page), so revision 6+ is now OBSOLETE! A little practical (not theoretical) improvement was done in BMH fragment, namely the comparison of first byte (in the inlined memcmp() part) was replaced by comparison of first 4 bytes, in fact r.6++ differs from r.6+ only in BMH fragment.

Update: Last night (2011 Aug 30) it took me 3-4 hours to tweak the revision 6, which resulted in 6+ (downloadable at bottom of the page), so revision 6 is now OBSOLETE!

The C source of Railgun_Doublet follows:
// All Railgun variants are written by Georgi 'Kaze', they are free, however I expect the user to mention its homepage, that is: http://www.sanmayce.com/Railgun/index.html
// Author's email: sanmayce@sanmayce.com
// Caution: For better speed the case 'if (cbPattern==1)' was removed, so Pattern must be longer than 1 char.
char * Railgun_Doublet (char * pbTarget, char * pbPattern, uint32_t cbTarget, uint32_t cbPattern)
{
	char * pbTargetMax = pbTarget + cbTarget;
	register uint32_t ulHashPattern;
	uint32_t ulHashTarget, count, countSTATIC;

	if (cbPattern > cbTarget) return(NULL);

	countSTATIC = cbPattern-2;

	pbTarget = pbTarget+cbPattern;
	ulHashPattern = (*(uint16_t *)(pbPattern));

	for ( ;; ) {
		if ( ulHashPattern == (*(uint16_t *)(pbTarget-cbPattern)) ) {
			count = countSTATIC;
			while ( count && *(char *)(pbPattern+2+(countSTATIC-count)) == *(char *)(pbTarget-cbPattern+2+(countSTATIC-count)) ) {
				count--;
			}
			if ( count == 0 ) return((pbTarget-cbPattern));
		}
		pbTarget++;
		if (pbTarget > pbTargetMax) return(NULL);
	}
}
/*
; Listing generated by: Microsoft (R) C/C++ Optimizing Compiler Version 16.00.30319.01 for x64
PUBLIC	Railgun_Doublet
pdata	SEGMENT
$pdata$Railgun_Doublet DD imagerel $LN21
	DD	imagerel $LN21+25
	DD	imagerel $unwind$Railgun_Doublet
$pdata$2$Railgun_Doublet DD imagerel $LN21+25
	DD	imagerel $LN21+136
	DD	imagerel $chain$2$Railgun_Doublet
$pdata$4$Railgun_Doublet DD imagerel $LN21+136
	DD	imagerel $LN21+171
	DD	imagerel $chain$4$Railgun_Doublet
pdata	ENDS
xdata	SEGMENT
$unwind$Railgun_Doublet DD 020301H
	DD	030026003H
$chain$2$Railgun_Doublet DD 061221H
	DD	06c412H
	DD	05740aH
	DD	045405H
	DD	imagerel $LN21
	DD	imagerel $LN21+25
	DD	imagerel $unwind$Railgun_Doublet
$chain$4$Railgun_Doublet DD 060021H
	DD	06c400H
	DD	057400H
	DD	045400H
	DD	imagerel $LN21
	DD	imagerel $LN21+25
	DD	imagerel $unwind$Railgun_Doublet
; Function compile flags: /Ogtpy
xdata	ENDS
_TEXT	SEGMENT
tv169 = 24
pbTarget$ = 24
pbPattern$ = 32
cbTarget$ = 40
cbPattern$ = 48
Railgun_Doublet PROC

; 2639 : {

$LN21:
  00c30	40 53		 push	 rbx
  00c32	56		 push	 rsi

; 2640 : 	char * pbTargetMax = pbTarget + cbTarget;

  00c33	41 8b d8	 mov	 ebx, r8d
  00c36	48 8b f2	 mov	 rsi, rdx
  00c39	4c 8b d1	 mov	 r10, rcx
  00c3c	48 03 d9	 add	 rbx, rcx

; 2641 : 	register uint32_t ulHashPattern;
; 2642 : 	uint32_t ulHashTarget, count, countSTATIC;
; 2643 : 
; 2644 : 	if (cbPattern > cbTarget) return(NULL);

  00c3f	45 3b c8	 cmp	 r9d, r8d
  00c42	76 05		 jbe	 SHORT $LN8@Railgun_du
  00c44	33 c0		 xor	 eax, eax

; 2662 : }

  00c46	5e		 pop	 rsi
  00c47	5b		 pop	 rbx
  00c48	c3		 ret	 0
$LN8@Railgun_du:
  00c49	48 89 6c 24 20	 mov	 QWORD PTR [rsp+32], rbp
  00c4e	48 89 7c 24 28	 mov	 QWORD PTR [rsp+40], rdi

; 2645 : 
; 2646 : 	countSTATIC = cbPattern-2;
; 2647 : 
; 2648 : 	pbTarget = pbTarget+cbPattern;
; 2649 : 	ulHashPattern = (*(uint16_t *)(pbPattern));

  00c53	0f b7 3a	 movzx	 edi, WORD PTR [rdx]
  00c56	4c 89 64 24 30	 mov	 QWORD PTR [rsp+48], r12
  00c5b	45 8b e1	 mov	 r12d, r9d

; 2661 : 	}

  00c5e	48 8b ea	 mov	 rbp, rdx
  00c61	4d 03 d4	 add	 r10, r12
  00c64	45 8d 59 fe	 lea	 r11d, DWORD PTR [r9-2]
  00c68	4d 8b c2	 mov	 r8, r10
  00c6b	4d 2b c4	 sub	 r8, r12
  00c6e	48 f7 dd	 neg	 rbp
$LL7@Railgun_du:

; 2650 : 
; 2651 : 	for ( ;; ) {
; 2652 : 		if ( ulHashPattern == (*(uint16_t *)(pbTarget-cbPattern)) ) {

  00c71	41 0f b7 00	 movzx	 eax, WORD PTR [r8]
  00c75	3b f8		 cmp	 edi, eax
  00c77	75 43		 jne	 SHORT $LN2@Railgun_du

; 2653 : 			count = countSTATIC;

  00c79	41 8b d3	 mov	 edx, r11d

; 2654 : 			while ( count && *(char *)(pbPattern+2+(countSTATIC-count)) == *(char *)(pbTarget-cbPattern+2+(countSTATIC-count)) ) {

  00c7c	45 85 db	 test	 r11d, r11d
  00c7f	74 1f		 je	 SHORT $LN17@Railgun_du
  00c81	48 8d 4e 02	 lea	 rcx, QWORD PTR [rsi+2]
  00c85	4d 8d 0c 28	 lea	 r9, QWORD PTR [r8+rbp]
  00c89	0f 1f 80 00 00
	00 00		 npad	 7
$LL4@Railgun_du:
  00c90	41 0f b6 04 09	 movzx	 eax, BYTE PTR [r9+rcx]
  00c95	38 01		 cmp	 BYTE PTR [rcx], al
  00c97	75 1f		 jne	 SHORT $LN3@Railgun_du

; 2655 : 				count--;

  00c99	48 ff c1	 inc	 rcx
  00c9c	ff ca		 dec	 edx
  00c9e	75 f0		 jne	 SHORT $LL4@Railgun_du
$LN17@Railgun_du:
  00ca0	48 8b 7c 24 28	 mov	 rdi, QWORD PTR [rsp+40]
  00ca5	48 8b 6c 24 20	 mov	 rbp, QWORD PTR [rsp+32]

; 2656 : 			}
; 2657 : 			if ( count == 0 ) return((pbTarget-cbPattern));

  00caa	4d 2b d4	 sub	 r10, r12
  00cad	4c 8b 64 24 30	 mov	 r12, QWORD PTR [rsp+48]
  00cb2	49 8b c2	 mov	 rax, r10

; 2662 : }

  00cb5	5e		 pop	 rsi
  00cb6	5b		 pop	 rbx
  00cb7	c3		 ret	 0
$LN3@Railgun_du:

; 2656 : 			}
; 2657 : 			if ( count == 0 ) return((pbTarget-cbPattern));

  00cb8	85 d2		 test	 edx, edx
  00cba	74 e4		 je	 SHORT $LN17@Railgun_du
$LN2@Railgun_du:

; 2658 : 		}
; 2659 : 		pbTarget++;

  00cbc	49 ff c2	 inc	 r10
  00cbf	49 ff c0	 inc	 r8

; 2660 : 		if (pbTarget > pbTargetMax) return(NULL);

  00cc2	4c 3b d3	 cmp	 r10, rbx
  00cc5	76 aa		 jbe	 SHORT $LL7@Railgun_du
  00cc7	48 8b 7c 24 28	 mov	 rdi, QWORD PTR [rsp+40]
  00ccc	48 8b 6c 24 20	 mov	 rbp, QWORD PTR [rsp+32]
  00cd1	4c 8b 64 24 30	 mov	 r12, QWORD PTR [rsp+48]
  00cd6	33 c0		 xor	 eax, eax

; 2662 : }

  00cd8	5e		 pop	 rsi
  00cd9	5b		 pop	 rbx
  00cda	c3		 ret	 0
Railgun_Doublet ENDP
_TEXT	ENDS
*/
//
/*
Testbed: [File: OSHO.TXT 206,908,949 bytes; LinesEncountered: 2,459,508; Windows 7 64bit; Microsoft 2010 64bit compiler; E7500 2.93GHz dual DDR2]

Searching for Pattern('an',2bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 1212509/544
strstr_Microsoft performance: 248KB/clock
StrnglenTRAVERSED: 138478024 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1212509/359
strstr_GNU_C_Library performance: 376KB/clock
StrnglenTRAVERSED: 138478024 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 1212509/321
Railgun_Doublet performance: 421KB/clock
StrnglenTRAVERSED: 138478024 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 1212509/335
Railgun_Quadruplet_8Triplet performance: 403KB/clock
StrnglenTRAVERSED: 138478024 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 1212509/348
Railgun_Mischa_8Triplet performance: 388KB/clock
StrnglenTRAVERSED: 138478024 bytes

BNDM_32_hits/BNDM_32_clocks: 1212509/505
BNDM_32 performance: 267KB/clock
StrnglenTRAVERSED: 138478024 bytes

Searching for Pattern('to',2bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 780175/616
strstr_Microsoft performance: 260KB/clock
StrnglenTRAVERSED: 164505415 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 780175/401
strstr_GNU_C_Library performance: 400KB/clock
StrnglenTRAVERSED: 164505415 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 780175/337
Railgun_Doublet performance: 476KB/clock
StrnglenTRAVERSED: 164505415 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 780175/366
Railgun_Quadruplet_8Triplet performance: 438KB/clock
StrnglenTRAVERSED: 164505415 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 780175/379
Railgun_Mischa_8Triplet performance: 423KB/clock
StrnglenTRAVERSED: 164505415 bytes

BNDM_32_hits/BNDM_32_clocks: 780175/553
BNDM_32 performance: 290KB/clock
StrnglenTRAVERSED: 164505415 bytes

Searching for Pattern('TDK',3bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/627
strstr_Microsoft performance: 318KB/clock
StrnglenTRAVERSED: 204449441 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/354
strstr_GNU_C_Library performance: 564KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 0/362
Railgun_Doublet performance: 551KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 0/354
Railgun_Quadruplet_8Triplet performance: 564KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 0/359
Railgun_Mischa_8Triplet performance: 556KB/clock
StrnglenTRAVERSED: 204449441 bytes

BNDM_32_hits/BNDM_32_clocks: 0/432
BNDM_32 performance: 462KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('the',3bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 1192002/568
strstr_Microsoft performance: 233KB/clock
StrnglenTRAVERSED: 135882884 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1192002/383
strstr_GNU_C_Library performance: 346KB/clock
StrnglenTRAVERSED: 135882884 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 1192002/337
Railgun_Doublet performance: 393KB/clock
StrnglenTRAVERSED: 135882884 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 1192002/354
Railgun_Quadruplet_8Triplet performance: 374KB/clock
StrnglenTRAVERSED: 135882884 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 1192002/363
Railgun_Mischa_8Triplet performance: 365KB/clock
StrnglenTRAVERSED: 135882884 bytes

BNDM_32_hits/BNDM_32_clocks: 1192002/519
BNDM_32 performance: 255KB/clock
StrnglenTRAVERSED: 135882884 bytes

Searching for Pattern('fast',4bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 5384/640
strstr_Microsoft performance: 311KB/clock
StrnglenTRAVERSED: 204186782 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 5384/369
strstr_GNU_C_Library performance: 540KB/clock
StrnglenTRAVERSED: 204186782 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 5384/362
Railgun_Doublet performance: 550KB/clock
StrnglenTRAVERSED: 204186782 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 5384/485
Railgun_Quadruplet_8Triplet performance: 411KB/clock
StrnglenTRAVERSED: 204186782 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 5384/429
Railgun_Mischa_8Triplet performance: 464KB/clock
StrnglenTRAVERSED: 204186782 bytes

BNDM_32_hits/BNDM_32_clocks: 5384/510
BNDM_32 performance: 390KB/clock
StrnglenTRAVERSED: 204186782 bytes

Searching for Pattern('easy',4bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 4825/771
strstr_Microsoft performance: 258KB/clock
StrnglenTRAVERSED: 204202166 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 4825/504
strstr_GNU_C_Library performance: 395KB/clock
StrnglenTRAVERSED: 204202166 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 4825/373
Railgun_Doublet performance: 534KB/clock
StrnglenTRAVERSED: 204202166 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 4825/549
Railgun_Quadruplet_8Triplet performance: 363KB/clock
StrnglenTRAVERSED: 204202166 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 4825/429
Railgun_Mischa_8Triplet performance: 464KB/clock
StrnglenTRAVERSED: 204202166 bytes

BNDM_32_hits/BNDM_32_clocks: 4825/526
BNDM_32 performance: 379KB/clock
StrnglenTRAVERSED: 204202166 bytes

Searching for Pattern('grmbl',5bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/645
strstr_Microsoft performance: 309KB/clock
StrnglenTRAVERSED: 204449441 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/373
strstr_GNU_C_Library performance: 535KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 0/361
Railgun_Doublet performance: 553KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 0/483
Railgun_Quadruplet_8Triplet performance: 413KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 0/429
Railgun_Mischa_8Triplet performance: 465KB/clock
StrnglenTRAVERSED: 204449441 bytes

BNDM_32_hits/BNDM_32_clocks: 0/442
BNDM_32 performance: 451KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('email',5bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 1/764
strstr_Microsoft performance: 261KB/clock
StrnglenTRAVERSED: 204449414 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1/497
strstr_GNU_C_Library performance: 401KB/clock
StrnglenTRAVERSED: 204449414 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 1/363
Railgun_Doublet performance: 550KB/clock
StrnglenTRAVERSED: 204449414 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 1/546
Railgun_Quadruplet_8Triplet performance: 365KB/clock
StrnglenTRAVERSED: 204449414 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 1/429
Railgun_Mischa_8Triplet performance: 465KB/clock
StrnglenTRAVERSED: 204449414 bytes

BNDM_32_hits/BNDM_32_clocks: 1/505
BNDM_32 performance: 395KB/clock
StrnglenTRAVERSED: 204449414 bytes

Searching for Pattern('pasting',7bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 2/640
strstr_Microsoft performance: 311KB/clock
StrnglenTRAVERSED: 204449363 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 2/368
strstr_GNU_C_Library performance: 542KB/clock
StrnglenTRAVERSED: 204449363 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 2/357
Railgun_Doublet performance: 559KB/clock
StrnglenTRAVERSED: 204449363 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 2/475
Railgun_Quadruplet_8Triplet performance: 420KB/clock
StrnglenTRAVERSED: 204449363 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 2/429
Railgun_Mischa_8Triplet performance: 465KB/clock
StrnglenTRAVERSED: 204449363 bytes

BNDM_32_hits/BNDM_32_clocks: 2/498
BNDM_32 performance: 400KB/clock
StrnglenTRAVERSED: 204449363 bytes

Searching for Pattern('amazing',7bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 319/710
strstr_Microsoft performance: 281KB/clock
StrnglenTRAVERSED: 204432134 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 319/438
strstr_GNU_C_Library performance: 455KB/clock
StrnglenTRAVERSED: 204432134 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 319/358
Railgun_Doublet performance: 557KB/clock
StrnglenTRAVERSED: 204432134 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 319/506
Railgun_Quadruplet_8Triplet performance: 394KB/clock
StrnglenTRAVERSED: 204432134 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 319/429
Railgun_Mischa_8Triplet performance: 465KB/clock
StrnglenTRAVERSED: 204432134 bytes

BNDM_32_hits/BNDM_32_clocks: 319/461
BNDM_32 performance: 433KB/clock
StrnglenTRAVERSED: 204432134 bytes

Searching for Pattern('underdog',8bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 4/665
strstr_Microsoft performance: 300KB/clock
StrnglenTRAVERSED: 204449185 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 4/391
strstr_GNU_C_Library performance: 510KB/clock
StrnglenTRAVERSED: 204449185 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 4/361
Railgun_Doublet performance: 553KB/clock
StrnglenTRAVERSED: 204449185 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 4/482
Railgun_Quadruplet_8Triplet performance: 414KB/clock
StrnglenTRAVERSED: 204449185 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 4/430
Railgun_Mischa_8Triplet performance: 464KB/clock
StrnglenTRAVERSED: 204449185 bytes

BNDM_32_hits/BNDM_32_clocks: 4/476
BNDM_32 performance: 419KB/clock
StrnglenTRAVERSED: 204449185 bytes

Searching for Pattern('superdog',8bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/695
strstr_Microsoft performance: 287KB/clock
StrnglenTRAVERSED: 204449441 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/426
strstr_GNU_C_Library performance: 468KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 0/355
Railgun_Doublet performance: 562KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 0/500
Railgun_Quadruplet_8Triplet performance: 399KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 0/430
Railgun_Mischa_8Triplet performance: 464KB/clock
StrnglenTRAVERSED: 204449441 bytes

BNDM_32_hits/BNDM_32_clocks: 0/475
BNDM_32 performance: 420KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('participants',12bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 141/640
strstr_Microsoft performance: 311KB/clock
StrnglenTRAVERSED: 204441500 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 141/369
strstr_GNU_C_Library performance: 541KB/clock
StrnglenTRAVERSED: 204441500 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 141/351
Railgun_Doublet performance: 568KB/clock
StrnglenTRAVERSED: 204441500 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 141/460
Railgun_Quadruplet_8Triplet performance: 434KB/clock
StrnglenTRAVERSED: 204441500 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 141/429
Railgun_Mischa_8Triplet performance: 465KB/clock
StrnglenTRAVERSED: 204441500 bytes

BNDM_32_hits/BNDM_32_clocks: 141/457
BNDM_32 performance: 436KB/clock
StrnglenTRAVERSED: 204441500 bytes

Searching for Pattern('skillessness',12bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/695
strstr_Microsoft performance: 287KB/clock
StrnglenTRAVERSED: 204449441 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/425
strstr_GNU_C_Library performance: 469KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 0/348
Railgun_Doublet performance: 573KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 0/486
Railgun_Quadruplet_8Triplet performance: 410KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 0/428
Railgun_Mischa_8Triplet performance: 466KB/clock
StrnglenTRAVERSED: 204449441 bytes

BNDM_32_hits/BNDM_32_clocks: 0/446
BNDM_32 performance: 447KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('I should have known',19bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 1/630
strstr_Microsoft performance: 316KB/clock
StrnglenTRAVERSED: 204449346 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1/358
strstr_GNU_C_Library performance: 557KB/clock
StrnglenTRAVERSED: 204449346 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 1/340
Railgun_Doublet performance: 587KB/clock
StrnglenTRAVERSED: 204449346 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 1/433
Railgun_Quadruplet_8Triplet performance: 461KB/clock
StrnglenTRAVERSED: 204449346 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 1/428
Railgun_Mischa_8Triplet performance: 466KB/clock
StrnglenTRAVERSED: 204449346 bytes

BNDM_32_hits/BNDM_32_clocks: 1/458
BNDM_32 performance: 435KB/clock
StrnglenTRAVERSED: 204449346 bytes

Searching for Pattern('human consciousness',19bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 514/686
strstr_Microsoft performance: 291KB/clock
StrnglenTRAVERSED: 204422699 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 514/414
strstr_GNU_C_Library performance: 482KB/clock
StrnglenTRAVERSED: 204422699 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 514/336
Railgun_Doublet performance: 594KB/clock
StrnglenTRAVERSED: 204422699 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 514/456
Railgun_Quadruplet_8Triplet performance: 437KB/clock
StrnglenTRAVERSED: 204422699 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 514/428
Railgun_Mischa_8Triplet performance: 466KB/clock
StrnglenTRAVERSED: 204422699 bytes

BNDM_32_hits/BNDM_32_clocks: 514/452
BNDM_32 performance: 441KB/clock
StrnglenTRAVERSED: 204422699 bytes

D:\_KAZE_strstr_SHORT-SHOWDOWN_7Trident2_7Hasherezade_7Gulliver2>
*/
//
/*
Testbed: [File: OSHO.TXT 206,908,949 bytes; LinesEncountered: 2,459,508; Windows 7 64bit; Intel 2011 64bit compiler; E7500 2.93GHz dual DDR2]

Searching for Pattern('an',2bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 1212509/567
strstr_Microsoft performance: 238KB/clock
StrnglenTRAVERSED: 138478024 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1212509/456
strstr_GNU_C_Library performance: 296KB/clock
StrnglenTRAVERSED: 138478024 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 1212509/388
Railgun_Doublet performance: 348KB/clock
StrnglenTRAVERSED: 138478024 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 1212509/417
Railgun_Quadruplet_8Triplet performance: 324KB/clock
StrnglenTRAVERSED: 138478024 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 1212509/406
Railgun_Mischa_8Triplet performance: 333KB/clock
StrnglenTRAVERSED: 138478024 bytes

BNDM_32_hits/BNDM_32_clocks: 1212509/559
BNDM_32 performance: 241KB/clock
StrnglenTRAVERSED: 138478024 bytes

Searching for Pattern('to',2bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 780175/628
strstr_Microsoft performance: 255KB/clock
StrnglenTRAVERSED: 164505415 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 780175/502
strstr_GNU_C_Library performance: 320KB/clock
StrnglenTRAVERSED: 164505415 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 780175/404
Railgun_Doublet performance: 397KB/clock
StrnglenTRAVERSED: 164505415 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 780175/451
Railgun_Quadruplet_8Triplet performance: 356KB/clock
StrnglenTRAVERSED: 164505415 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 780175/439
Railgun_Mischa_8Triplet performance: 365KB/clock
StrnglenTRAVERSED: 164505415 bytes

BNDM_32_hits/BNDM_32_clocks: 780175/611
BNDM_32 performance: 262KB/clock
StrnglenTRAVERSED: 164505415 bytes

Searching for Pattern('TDK',3bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/618
strstr_Microsoft performance: 323KB/clock
StrnglenTRAVERSED: 204449441 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/474
strstr_GNU_C_Library performance: 421KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 0/430
Railgun_Doublet performance: 464KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 0/436
Railgun_Quadruplet_8Triplet performance: 457KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 0/511
Railgun_Mischa_8Triplet performance: 390KB/clock
StrnglenTRAVERSED: 204449441 bytes

BNDM_32_hits/BNDM_32_clocks: 0/488
BNDM_32 performance: 409KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('the',3bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 1192002/584
strstr_Microsoft performance: 227KB/clock
StrnglenTRAVERSED: 135882884 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1192002/480
strstr_GNU_C_Library performance: 276KB/clock
StrnglenTRAVERSED: 135882884 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 1192002/404
Railgun_Doublet performance: 328KB/clock
StrnglenTRAVERSED: 135882884 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 1192002/427
Railgun_Quadruplet_8Triplet performance: 310KB/clock
StrnglenTRAVERSED: 135882884 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 1192002/454
Railgun_Mischa_8Triplet performance: 292KB/clock
StrnglenTRAVERSED: 135882884 bytes

BNDM_32_hits/BNDM_32_clocks: 1192002/567
BNDM_32 performance: 234KB/clock
StrnglenTRAVERSED: 135882884 bytes

Searching for Pattern('fast',4bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 5384/633
strstr_Microsoft performance: 315KB/clock
StrnglenTRAVERSED: 204186782 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 5384/478
strstr_GNU_C_Library performance: 417KB/clock
StrnglenTRAVERSED: 204186782 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 5384/430
Railgun_Doublet performance: 463KB/clock
StrnglenTRAVERSED: 204186782 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 5384/558
Railgun_Quadruplet_8Triplet performance: 357KB/clock
StrnglenTRAVERSED: 204186782 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 5384/483
Railgun_Mischa_8Triplet performance: 412KB/clock
StrnglenTRAVERSED: 204186782 bytes

BNDM_32_hits/BNDM_32_clocks: 5384/565
BNDM_32 performance: 352KB/clock
StrnglenTRAVERSED: 204186782 bytes

Searching for Pattern('easy',4bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 4825/773
strstr_Microsoft performance: 257KB/clock
StrnglenTRAVERSED: 204202166 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 4825/617
strstr_GNU_C_Library performance: 323KB/clock
StrnglenTRAVERSED: 204202166 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 4825/441
Railgun_Doublet performance: 452KB/clock
StrnglenTRAVERSED: 204202166 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 4825/619
Railgun_Quadruplet_8Triplet performance: 322KB/clock
StrnglenTRAVERSED: 204202166 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 4825/483
Railgun_Mischa_8Triplet performance: 412KB/clock
StrnglenTRAVERSED: 204202166 bytes

BNDM_32_hits/BNDM_32_clocks: 4825/580
BNDM_32 performance: 343KB/clock
StrnglenTRAVERSED: 204202166 bytes

Searching for Pattern('grmbl',5bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/635
strstr_Microsoft performance: 314KB/clock
StrnglenTRAVERSED: 204449441 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/481
strstr_GNU_C_Library performance: 415KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 0/429
Railgun_Doublet performance: 465KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 0/554
Railgun_Quadruplet_8Triplet performance: 360KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 0/484
Railgun_Mischa_8Triplet performance: 412KB/clock
StrnglenTRAVERSED: 204449441 bytes

BNDM_32_hits/BNDM_32_clocks: 0/496
BNDM_32 performance: 402KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('email',5bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 1/767
strstr_Microsoft performance: 260KB/clock
StrnglenTRAVERSED: 204449414 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1/611
strstr_GNU_C_Library performance: 326KB/clock
StrnglenTRAVERSED: 204449414 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 1/431
Railgun_Doublet performance: 463KB/clock
StrnglenTRAVERSED: 204449414 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 1/616
Railgun_Quadruplet_8Triplet performance: 324KB/clock
StrnglenTRAVERSED: 204449414 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 1/484
Railgun_Mischa_8Triplet performance: 412KB/clock
StrnglenTRAVERSED: 204449414 bytes

BNDM_32_hits/BNDM_32_clocks: 1/556
BNDM_32 performance: 359KB/clock
StrnglenTRAVERSED: 204449414 bytes

Searching for Pattern('pasting',7bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 2/634
strstr_Microsoft performance: 314KB/clock
StrnglenTRAVERSED: 204449363 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 2/480
strstr_GNU_C_Library performance: 415KB/clock
StrnglenTRAVERSED: 204449363 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 2/425
Railgun_Doublet performance: 469KB/clock
StrnglenTRAVERSED: 204449363 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 2/547
Railgun_Quadruplet_8Triplet performance: 365KB/clock
StrnglenTRAVERSED: 204449363 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 2/484
Railgun_Mischa_8Triplet performance: 412KB/clock
StrnglenTRAVERSED: 204449363 bytes

BNDM_32_hits/BNDM_32_clocks: 2/544
BNDM_32 performance: 367KB/clock
StrnglenTRAVERSED: 204449363 bytes

Searching for Pattern('amazing',7bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 319/706
strstr_Microsoft performance: 282KB/clock
StrnglenTRAVERSED: 204432134 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 319/543
strstr_GNU_C_Library performance: 367KB/clock
StrnglenTRAVERSED: 204432134 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 319/426
Railgun_Doublet performance: 468KB/clock
StrnglenTRAVERSED: 204432134 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 319/577
Railgun_Quadruplet_8Triplet performance: 345KB/clock
StrnglenTRAVERSED: 204432134 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 319/483
Railgun_Mischa_8Triplet performance: 413KB/clock
StrnglenTRAVERSED: 204432134 bytes

BNDM_32_hits/BNDM_32_clocks: 319/509
BNDM_32 performance: 392KB/clock
StrnglenTRAVERSED: 204432134 bytes

Searching for Pattern('underdog',8bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 4/656
strstr_Microsoft performance: 304KB/clock
StrnglenTRAVERSED: 204449185 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 4/492
strstr_GNU_C_Library performance: 405KB/clock
StrnglenTRAVERSED: 204449185 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 4/430
Railgun_Doublet performance: 464KB/clock
StrnglenTRAVERSED: 204449185 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 4/553
Railgun_Quadruplet_8Triplet performance: 361KB/clock
StrnglenTRAVERSED: 204449185 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 4/484
Railgun_Mischa_8Triplet performance: 412KB/clock
StrnglenTRAVERSED: 204449185 bytes

BNDM_32_hits/BNDM_32_clocks: 4/521
BNDM_32 performance: 383KB/clock
StrnglenTRAVERSED: 204449185 bytes

Searching for Pattern('superdog',8bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/691
strstr_Microsoft performance: 288KB/clock
StrnglenTRAVERSED: 204449441 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/528
strstr_GNU_C_Library performance: 378KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 0/424
Railgun_Doublet performance: 470KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 0/571
Railgun_Quadruplet_8Triplet performance: 349KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 0/484
Railgun_Mischa_8Triplet performance: 412KB/clock
StrnglenTRAVERSED: 204449441 bytes

BNDM_32_hits/BNDM_32_clocks: 0/519
BNDM_32 performance: 384KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('participants',12bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 141/632
strstr_Microsoft performance: 315KB/clock
StrnglenTRAVERSED: 204441500 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 141/480
strstr_GNU_C_Library performance: 415KB/clock
StrnglenTRAVERSED: 204441500 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 141/418
Railgun_Doublet performance: 477KB/clock
StrnglenTRAVERSED: 204441500 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 141/532
Railgun_Quadruplet_8Triplet performance: 375KB/clock
StrnglenTRAVERSED: 204441500 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 141/483
Railgun_Mischa_8Triplet performance: 413KB/clock
StrnglenTRAVERSED: 204441500 bytes

BNDM_32_hits/BNDM_32_clocks: 141/501
BNDM_32 performance: 398KB/clock
StrnglenTRAVERSED: 204441500 bytes

Searching for Pattern('skillessness',12bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/689
strstr_Microsoft performance: 289KB/clock
StrnglenTRAVERSED: 204449441 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/527
strstr_GNU_C_Library performance: 378KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 0/416
Railgun_Doublet performance: 479KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 0/556
Railgun_Quadruplet_8Triplet performance: 359KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 0/482
Railgun_Mischa_8Triplet performance: 414KB/clock
StrnglenTRAVERSED: 204449441 bytes

BNDM_32_hits/BNDM_32_clocks: 0/490
BNDM_32 performance: 407KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('I should have known',19bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 1/623
strstr_Microsoft performance: 320KB/clock
StrnglenTRAVERSED: 204449346 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1/477
strstr_GNU_C_Library performance: 418KB/clock
StrnglenTRAVERSED: 204449346 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 1/407
Railgun_Doublet performance: 490KB/clock
StrnglenTRAVERSED: 204449346 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 1/505
Railgun_Quadruplet_8Triplet performance: 395KB/clock
StrnglenTRAVERSED: 204449346 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 1/483
Railgun_Mischa_8Triplet performance: 413KB/clock
StrnglenTRAVERSED: 204449346 bytes

BNDM_32_hits/BNDM_32_clocks: 1/498
BNDM_32 performance: 400KB/clock
StrnglenTRAVERSED: 204449346 bytes

Searching for Pattern('human consciousness',19bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 514/679
strstr_Microsoft performance: 294KB/clock
StrnglenTRAVERSED: 204422699 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 514/514
strstr_GNU_C_Library performance: 388KB/clock
StrnglenTRAVERSED: 204422699 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 514/404
Railgun_Doublet performance: 494KB/clock
StrnglenTRAVERSED: 204422699 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 514/526
Railgun_Quadruplet_8Triplet performance: 379KB/clock
StrnglenTRAVERSED: 204422699 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 514/482
Railgun_Mischa_8Triplet performance: 414KB/clock
StrnglenTRAVERSED: 204422699 bytes

BNDM_32_hits/BNDM_32_clocks: 514/492
BNDM_32 performance: 405KB/clock
StrnglenTRAVERSED: 204422699 bytes

D:\_KAZE_strstr_SHORT-SHOWDOWN_7Trident2_7Hasherezade_7Gulliver2>
*/
//
/*
; Listing generated by: Microsoft (R) 32-bit C/C++ Optimizing Compiler Version 16.00.30319.01 for 80x86
PUBLIC	_Railgun_Doublet
; Function compile flags: /Ogtpy
_TEXT	SEGMENT
_ulHashPattern$ = 8					; size = 4
_pbTarget$ = 8						; size = 4
_pbPattern$ = 12					; size = 4
_pbTargetMax$ = 16					; size = 4
_cbTarget$ = 16						; size = 4
_cbPattern$ = 20					; size = 4
_Railgun_Doublet PROC

; 2640 : 	char * pbTargetMax = pbTarget + cbTarget;

  009d0	8b 44 24 0c	 mov	 eax, DWORD PTR _cbTarget$[esp-4]
  009d4	53		 push	 ebx

; 2641 : 	register uint32_t ulHashPattern;
; 2642 : 	uint32_t ulHashTarget, count, countSTATIC;
; 2643 : 
; 2644 : 	if (cbPattern > cbTarget) return(NULL);

  009d5	8b 5c 24 14	 mov	 ebx, DWORD PTR _cbPattern$[esp]
  009d9	55		 push	 ebp
  009da	8b 6c 24 0c	 mov	 ebp, DWORD PTR _pbTarget$[esp+4]
  009de	8d 0c 28	 lea	 ecx, DWORD PTR [eax+ebp]
  009e1	89 4c 24 14	 mov	 DWORD PTR _pbTargetMax$[esp+4], ecx
  009e5	3b d8		 cmp	 ebx, eax
  009e7	76 05		 jbe	 SHORT $LN8@Railgun_du
  009e9	5d		 pop	 ebp
  009ea	33 c0		 xor	 eax, eax
  009ec	5b		 pop	 ebx

; 2661 : 	}
; 2662 : }

  009ed	c3		 ret	 0
$LN8@Railgun_du:

; 2645 : 
; 2646 : 	countSTATIC = cbPattern-2;
; 2647 : 
; 2648 : 	pbTarget = pbTarget+cbPattern;
; 2649 : 	ulHashPattern = (*(uint16_t *)(pbPattern));

  009ee	8b 54 24 10	 mov	 edx, DWORD PTR _pbPattern$[esp+4]
  009f2	0f b7 02	 movzx	 eax, WORD PTR [edx]
  009f5	57		 push	 edi
  009f6	03 eb		 add	 ebp, ebx
  009f8	8b fd		 mov	 edi, ebp
  009fa	89 44 24 10	 mov	 DWORD PTR _ulHashPattern$[esp+8], eax
  009fe	2b fb		 sub	 edi, ebx
  00a00	56		 push	 esi
$LL7@Railgun_du:

; 2650 : 
; 2651 : 	for ( ;; ) {
; 2652 : 		if ( ulHashPattern == (*(uint16_t *)(pbTarget-cbPattern)) ) {

  00a01	0f b7 0f	 movzx	 ecx, WORD PTR [edi]
  00a04	39 4c 24 14	 cmp	 DWORD PTR _ulHashPattern$[esp+12], ecx
  00a08	75 2e		 jne	 SHORT $LN2@Railgun_du

; 2653 : 			count = countSTATIC;

  00a0a	8d 4b fe	 lea	 ecx, DWORD PTR [ebx-2]

; 2654 : 			while ( count && *(char *)(pbPattern+2+(countSTATIC-count)) == *(char *)(pbTarget-cbPattern+2+(countSTATIC-count)) ) {

  00a0d	85 c9		 test	 ecx, ecx
  00a0f	74 1a		 je	 SHORT $LN17@Railgun_du

; 2653 : 			count = countSTATIC;

  00a11	8b 74 24 18	 mov	 esi, DWORD PTR _pbPattern$[esp+12]
  00a15	83 c6 02	 add	 esi, 2
  00a18	8d 57 02	 lea	 edx, DWORD PTR [edi+2]
  00a1b	eb 03 8d 49 00	 npad	 5
$LL4@Railgun_du:

; 2654 : 			while ( count && *(char *)(pbPattern+2+(countSTATIC-count)) == *(char *)(pbTarget-cbPattern+2+(countSTATIC-count)) ) {

  00a20	8a 06		 mov	 al, BYTE PTR [esi]
  00a22	3a 02		 cmp	 al, BYTE PTR [edx]
  00a24	75 0e		 jne	 SHORT $LN3@Railgun_du

; 2655 : 				count--;

  00a26	42		 inc	 edx
  00a27	46		 inc	 esi
  00a28	49		 dec	 ecx
  00a29	75 f5		 jne	 SHORT $LL4@Railgun_du
$LN17@Railgun_du:
  00a2b	5e		 pop	 esi
  00a2c	5f		 pop	 edi

; 2656 : 			}
; 2657 : 			if ( count == 0 ) return((pbTarget-cbPattern));

  00a2d	8b c5		 mov	 eax, ebp
  00a2f	5d		 pop	 ebp
  00a30	2b c3		 sub	 eax, ebx
  00a32	5b		 pop	 ebx

; 2661 : 	}
; 2662 : }

  00a33	c3		 ret	 0
$LN3@Railgun_du:

; 2656 : 			}
; 2657 : 			if ( count == 0 ) return((pbTarget-cbPattern));

  00a34	85 c9		 test	 ecx, ecx
  00a36	74 f3		 je	 SHORT $LN17@Railgun_du
$LN2@Railgun_du:

; 2658 : 		}
; 2659 : 		pbTarget++;

  00a38	45		 inc	 ebp
  00a39	47		 inc	 edi

; 2660 : 		if (pbTarget > pbTargetMax) return(NULL);

  00a3a	3b 6c 24 1c	 cmp	 ebp, DWORD PTR _pbTargetMax$[esp+12]
  00a3e	76 c1		 jbe	 SHORT $LL7@Railgun_du
  00a40	5e		 pop	 esi
  00a41	5f		 pop	 edi
  00a42	5d		 pop	 ebp
  00a43	33 c0		 xor	 eax, eax
  00a45	5b		 pop	 ebx

; 2661 : 	}
; 2662 : }

  00a46	c3		 ret	 0
_Railgun_Doublet ENDP
_TEXT	ENDS
*/
//
/*
Testbed: [File: OSHO.TXT 206,908,949 bytes; LinesEncountered: 2,459,508; Windows XP 32bit; Microsoft 2010 32bit compiler; T7500 2200MHz dual DDR2]

Searching for Pattern('an',2bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 1212509/684
strstr_Microsoft performance: 197KB/clock
StrnglenTRAVERSED: 138478024 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1212509/492
strstr_GNU_C_Library performance: 274KB/clock
StrnglenTRAVERSED: 138478024 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 1212509/493
Railgun_Doublet performance: 274KB/clock
StrnglenTRAVERSED: 138478024 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 1212509/442
Railgun_Quadruplet_8Triplet performance: 305KB/clock
StrnglenTRAVERSED: 138478024 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 1212509/435
Railgun_Mischa_8Triplet performance: 310KB/clock
StrnglenTRAVERSED: 138478024 bytes

BNDM_32_hits/BNDM_32_clocks: 1212509/625
BNDM_32 performance: 216KB/clock
StrnglenTRAVERSED: 138478024 bytes

Searching for Pattern('to',2bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 780175/765
strstr_Microsoft performance: 209KB/clock
StrnglenTRAVERSED: 164505415 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 780175/544
strstr_GNU_C_Library performance: 295KB/clock
StrnglenTRAVERSED: 164505415 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 780175/526
Railgun_Doublet performance: 305KB/clock
StrnglenTRAVERSED: 164505415 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 780175/482
Railgun_Quadruplet_8Triplet performance: 333KB/clock
StrnglenTRAVERSED: 164505415 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 780175/471
Railgun_Mischa_8Triplet performance: 341KB/clock
StrnglenTRAVERSED: 164505415 bytes

BNDM_32_hits/BNDM_32_clocks: 780175/688
BNDM_32 performance: 233KB/clock
StrnglenTRAVERSED: 164505415 bytes

Searching for Pattern('TDK',3bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/744
strstr_Microsoft performance: 268KB/clock
StrnglenTRAVERSED: 204449441 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/490
strstr_GNU_C_Library performance: 407KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 0/575
Railgun_Doublet performance: 347KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 0/453
Railgun_Quadruplet_8Triplet performance: 440KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 0/445
Railgun_Mischa_8Triplet performance: 448KB/clock
StrnglenTRAVERSED: 204449441 bytes

BNDM_32_hits/BNDM_32_clocks: 0/537
BNDM_32 performance: 371KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('the',3bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 1192002/704
strstr_Microsoft performance: 188KB/clock
StrnglenTRAVERSED: 135882884 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1192002/519
strstr_GNU_C_Library performance: 255KB/clock
StrnglenTRAVERSED: 135882884 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 1192002/545
Railgun_Doublet performance: 243KB/clock
StrnglenTRAVERSED: 135882884 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 1192002/467
Railgun_Quadruplet_8Triplet performance: 284KB/clock
StrnglenTRAVERSED: 135882884 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 1192002/457
Railgun_Mischa_8Triplet performance: 290KB/clock
StrnglenTRAVERSED: 135882884 bytes

BNDM_32_hits/BNDM_32_clocks: 1192002/645
BNDM_32 performance: 205KB/clock
StrnglenTRAVERSED: 135882884 bytes

Searching for Pattern('fast',4bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 5384/763
strstr_Microsoft performance: 261KB/clock
StrnglenTRAVERSED: 204186782 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 5384/507
strstr_GNU_C_Library performance: 393KB/clock
StrnglenTRAVERSED: 204186782 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 5384/574
Railgun_Doublet performance: 347KB/clock
StrnglenTRAVERSED: 204186782 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 5384/495
Railgun_Quadruplet_8Triplet performance: 402KB/clock
StrnglenTRAVERSED: 204186782 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 5384/580
Railgun_Mischa_8Triplet performance: 343KB/clock
StrnglenTRAVERSED: 204186782 bytes

BNDM_32_hits/BNDM_32_clocks: 5384/635
BNDM_32 performance: 314KB/clock
StrnglenTRAVERSED: 204186782 bytes

Searching for Pattern('easy',4bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 4825/961
strstr_Microsoft performance: 207KB/clock
StrnglenTRAVERSED: 204202166 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 4825/673
strstr_GNU_C_Library performance: 296KB/clock
StrnglenTRAVERSED: 204202166 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 4825/586
Railgun_Doublet performance: 340KB/clock
StrnglenTRAVERSED: 204202166 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 4825/654
Railgun_Quadruplet_8Triplet performance: 304KB/clock
StrnglenTRAVERSED: 204202166 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 4825/580
Railgun_Mischa_8Triplet performance: 343KB/clock
StrnglenTRAVERSED: 204202166 bytes

BNDM_32_hits/BNDM_32_clocks: 4825/655
BNDM_32 performance: 304KB/clock
StrnglenTRAVERSED: 204202166 bytes

Searching for Pattern('grmbl',5bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/769
strstr_Microsoft performance: 259KB/clock
StrnglenTRAVERSED: 204449441 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/512
strstr_GNU_C_Library performance: 389KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 0/571
Railgun_Doublet performance: 349KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 0/497
Railgun_Quadruplet_8Triplet performance: 401KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 0/580
Railgun_Mischa_8Triplet performance: 344KB/clock
StrnglenTRAVERSED: 204449441 bytes

BNDM_32_hits/BNDM_32_clocks: 0/547
BNDM_32 performance: 365KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('email',5bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 1/953
strstr_Microsoft performance: 209KB/clock
StrnglenTRAVERSED: 204449414 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1/664
strstr_GNU_C_Library performance: 300KB/clock
StrnglenTRAVERSED: 204449414 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 1/574
Railgun_Doublet performance: 347KB/clock
StrnglenTRAVERSED: 204449414 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 1/653
Railgun_Quadruplet_8Triplet performance: 305KB/clock
StrnglenTRAVERSED: 204449414 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 1/580
Railgun_Mischa_8Triplet performance: 344KB/clock
StrnglenTRAVERSED: 204449414 bytes

BNDM_32_hits/BNDM_32_clocks: 1/626
BNDM_32 performance: 318KB/clock
StrnglenTRAVERSED: 204449414 bytes

Searching for Pattern('pasting',7bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 2/763
strstr_Microsoft performance: 261KB/clock
StrnglenTRAVERSED: 204449363 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 2/506
strstr_GNU_C_Library performance: 394KB/clock
StrnglenTRAVERSED: 204449363 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 2/565
Railgun_Doublet performance: 353KB/clock
StrnglenTRAVERSED: 204449363 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 2/488
Railgun_Quadruplet_8Triplet performance: 409KB/clock
StrnglenTRAVERSED: 204449363 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 2/581
Railgun_Mischa_8Triplet performance: 343KB/clock
StrnglenTRAVERSED: 204449363 bytes

BNDM_32_hits/BNDM_32_clocks: 2/617
BNDM_32 performance: 323KB/clock
StrnglenTRAVERSED: 204449363 bytes

Searching for Pattern('amazing',7bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 319/871
strstr_Microsoft performance: 229KB/clock
StrnglenTRAVERSED: 204432134 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 319/592
strstr_GNU_C_Library performance: 337KB/clock
StrnglenTRAVERSED: 204432134 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 319/565
Railgun_Doublet performance: 353KB/clock
StrnglenTRAVERSED: 204432134 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 319/569
Railgun_Quadruplet_8Triplet performance: 350KB/clock
StrnglenTRAVERSED: 204432134 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 319/580
Railgun_Mischa_8Triplet performance: 344KB/clock
StrnglenTRAVERSED: 204432134 bytes

BNDM_32_hits/BNDM_32_clocks: 319/569
BNDM_32 performance: 350KB/clock
StrnglenTRAVERSED: 204432134 bytes

Searching for Pattern('underdog',8bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 4/799
strstr_Microsoft performance: 249KB/clock
StrnglenTRAVERSED: 204449185 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 4/533
strstr_GNU_C_Library performance: 374KB/clock
StrnglenTRAVERSED: 204449185 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 4/568
Railgun_Doublet performance: 351KB/clock
StrnglenTRAVERSED: 204449185 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 4/510
Railgun_Quadruplet_8Triplet performance: 391KB/clock
StrnglenTRAVERSED: 204449185 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 4/581
Railgun_Mischa_8Triplet performance: 343KB/clock
StrnglenTRAVERSED: 204449185 bytes

BNDM_32_hits/BNDM_32_clocks: 4/587
BNDM_32 performance: 340KB/clock
StrnglenTRAVERSED: 204449185 bytes

Searching for Pattern('superdog',8bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/848
strstr_Microsoft performance: 235KB/clock
StrnglenTRAVERSED: 204449441 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/578
strstr_GNU_C_Library performance: 345KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 0/562
Railgun_Doublet performance: 355KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 0/556
Railgun_Quadruplet_8Triplet performance: 359KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 0/580
Railgun_Mischa_8Triplet performance: 344KB/clock
StrnglenTRAVERSED: 204449441 bytes

BNDM_32_hits/BNDM_32_clocks: 0/585
BNDM_32 performance: 341KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('participants',12bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 141/763
strstr_Microsoft performance: 261KB/clock
StrnglenTRAVERSED: 204441500 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 141/507
strstr_GNU_C_Library performance: 393KB/clock
StrnglenTRAVERSED: 204441500 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 141/549
Railgun_Doublet performance: 363KB/clock
StrnglenTRAVERSED: 204441500 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 141/478
Railgun_Quadruplet_8Triplet performance: 417KB/clock
StrnglenTRAVERSED: 204441500 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 141/580
Railgun_Mischa_8Triplet performance: 344KB/clock
StrnglenTRAVERSED: 204441500 bytes

BNDM_32_hits/BNDM_32_clocks: 141/560
BNDM_32 performance: 356KB/clock
StrnglenTRAVERSED: 204441500 bytes

Searching for Pattern('skillessness',12bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/846
strstr_Microsoft performance: 236KB/clock
StrnglenTRAVERSED: 204449441 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/576
strstr_GNU_C_Library performance: 346KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 0/547
Railgun_Doublet performance: 365KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 0/543
Railgun_Quadruplet_8Triplet performance: 367KB/clock
StrnglenTRAVERSED: 204449441 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 0/580
Railgun_Mischa_8Triplet performance: 344KB/clock
StrnglenTRAVERSED: 204449441 bytes

BNDM_32_hits/BNDM_32_clocks: 0/546
BNDM_32 performance: 365KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('I should have known',19bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 1/751
strstr_Microsoft performance: 265KB/clock
StrnglenTRAVERSED: 204449346 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1/495
strstr_GNU_C_Library performance: 403KB/clock
StrnglenTRAVERSED: 204449346 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 1/528
Railgun_Doublet performance: 378KB/clock
StrnglenTRAVERSED: 204449346 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 1/450
Railgun_Quadruplet_8Triplet performance: 443KB/clock
StrnglenTRAVERSED: 204449346 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 1/580
Railgun_Mischa_8Triplet performance: 344KB/clock
StrnglenTRAVERSED: 204449346 bytes

BNDM_32_hits/BNDM_32_clocks: 1/553
BNDM_32 performance: 361KB/clock
StrnglenTRAVERSED: 204449346 bytes

Searching for Pattern('human consciousness',19bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft_hits/strstr_Microsoft_clocks: 514/834
strstr_Microsoft performance: 239KB/clock
StrnglenTRAVERSED: 204422699 bytes

strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 514/563
strstr_GNU_C_Library performance: 354KB/clock
StrnglenTRAVERSED: 204422699 bytes

Railgun_Doublet_hits/Railgun_Doublet_clocks: 514/525
Railgun_Doublet performance: 380KB/clock
StrnglenTRAVERSED: 204422699 bytes

Railgun_Quadruplet_8Triplet_hits/Railgun_Quadruplet_8Triplet_clocks: 514/509
Railgun_Quadruplet_8Triplet performance: 392KB/clock
StrnglenTRAVERSED: 204422699 bytes

Railgun_Mischa_8Triplet_hits/Railgun_Mischa_8Triplet_clocks: 514/580
Railgun_Mischa_8Triplet performance: 344KB/clock
StrnglenTRAVERSED: 204422699 bytes

BNDM_32_hits/BNDM_32_clocks: 514/546
BNDM_32 performance: 365KB/clock
StrnglenTRAVERSED: 204422699 bytes

D:\_KAZE_strstr_SHORT-SHOWDOWN_7Trident2_7Hasherezade_7Gulliver2>
*/
//
// Notes on 80x86 and x64, 2012-Feb-25:
// Three compilers were used (first two on Windows 7 64bit, the third on Windows XP 32bit):
// Intel(R) C++ 64 Compiler XE for applications running on Intel(R) 64, Version 12.1.1.258 Build 20111011
// Microsoft (R) C/C++ Optimizing Compiler Version 16.00.30319.01 for x64
// Microsoft (R) 32-bit C/C++ Optimizing Compiler Version 16.00.30319.01 for 80x86
// I have been using x64 for more than 12 hours and quickly the picture has become clear: code written for 32bit must be replaced with dedicated 64bit counterpart, relying on former only is a gambling venture.
// For example Railgun_Doublet dominates when compiled as 64bit (both with Intel XE 2011 12.1 and Microsoft 2010 16.00.30319.01 for x64), but for 32bit it is inferior compared to Railgun_Quadruplet_8Triplet.
// Summary for strstr-like (i.e. memmem for short strings/patterns) usage:
// - for 32bit use Railgun_Quadruplet_8Triplet
// - for 64bit use Railgun_Doublet
// My interest has been shifted from strstr toward memmem, Railgun_Doublet will fill the gap (short strings/patterns cases) in Railgun_r8_Mimino_x64 whereas 'Trident2'+'Hasherezade' will deal with memmem part, 'Hasherezade' should be surely tuned for 64bit.
/*
A self-explanatory smackdown:

File: strstr_SHORT-SHOWDOWN_Microsoft_v16_Ox_64bit.exe
Testbed: Windows 7 64bit; Microsoft 2010 64bit compiler; E7500 2.93GHz dual DDR2
Target(as-one-line): OSHO.TXT 206908949 bytes

Pattern: fastest fox
Railgun_Quadruplet_7sun:         2000KB/clock / 0775%, 26672940 iterations
Railgun_Quadruplet_7Trident:     2149KB/clock / 0993%, 20834332 iterations BNDM screams here along with Horspool&Sunday
BNDM_32:                         1507KB/clock / 1038%, 19926393 iterations
Railgun_Quadruplet_7Gulliver:    2104KB/clock / 0977%, 21166516 iterations
Railgun_Quadruplet_7Hasherezade: 1961KB/clock / 0980%, 21112673 iterations

Pattern: fastest fox with biggest strides
Railgun_Quadruplet_7sun:         3061KB/clock / 1584%, 13060463 iterations
Railgun_Quadruplet_7Trident:     3424KB/clock / 3058%, 06765272 iterations
BNDM_32:                         3483KB/clock / 3113%, 06644708 iterations
Railgun_Quadruplet_7Gulliver:    3608KB/clock / 2924%, 07074287 iterations
Railgun_Quadruplet_7Hasherezade: 3367KB/clock / 3041%, 06801754 iterations Needs 64bit hand optimization!

File: strstr_SHORT-SHOWDOWN_Intel_O3_64bit.exe
Testbed: Windows 7 64bit; Intel C++ 64 Compiler XE 12.1; E7500 2.93GHz dual DDR2
Target(as-one-line): OSHO.TXT 206908949 bytes

Pattern: fastest fox
Railgun_Quadruplet_7sun:         1942KB/clock / 0775%, 26672940 iterations
Railgun_Quadruplet_7Trident:     2245KB/clock / 0993%, 20834332 iterations BNDM screams here along with Horspool&Sunday
BNDM_32:                         1507KB/clock / 1038%, 19926393 iterations
Railgun_Quadruplet_7Gulliver:    1870KB/clock / 0977%, 21166516 iterations
Railgun_Quadruplet_7Hasherezade: 1697KB/clock / 0980%, 21112673 iterations

Pattern: fastest fox with biggest strides
Railgun_Quadruplet_7sun:         3061KB/clock / 1584%, 13060463 iterations
Railgun_Quadruplet_7Trident:     3424KB/clock / 3058%, 06765272 iterations
BNDM_32:                         3544KB/clock / 3113%, 06644708 iterations
Railgun_Quadruplet_7Gulliver:    3608KB/clock / 2924%, 07074287 iterations
Railgun_Quadruplet_7Hasherezade: 3207KB/clock / 3041%, 06801754 iterations Needs 64bit hand optimization!

File: strstr_SHORT-SHOWDOWN_Microsoft_Ox_32bit.exe
Testbed: Windows XP 32bit; Microsoft 2010 32bit compiler; T7500 2200MHz dual DDR2
Target(as-one-line): OSHO.TXT 206908949 bytes

Pattern: fastest fox
Railgun_Quadruplet_7sun:         1683KB/clock / 0775%, 26672940 iterations
Railgun_Quadruplet_7Trident:     1888KB/clock / 0993%, 20834332 iterations
BNDM_32:                         1135KB/clock / 1038%, 19926393 iterations
Railgun_Quadruplet_7Gulliver:    1942KB/clock / 0977%, 21166516 iterations
Railgun_Quadruplet_7Hasherezade: 1757KB/clock / 0980%, 21112673 iterations
 
Pattern: fastest fox with biggest strides
Railgun_Quadruplet_7sun:         2658KB/clock / 1584%, 13060463 iterations
Railgun_Quadruplet_7Trident:     3015KB/clock / 3058%, 06765272 iterations
BNDM_32:                         2806KB/clock / 3113%, 06644708 iterations
Railgun_Quadruplet_7Gulliver:    3157KB/clock / 2924%, 07074287 iterations
Railgun_Quadruplet_7Hasherezade: 3061KB/clock / 3041%, 06801754 iterations

Bottom-line: Railgun_Quadruplet_7Trident is my choice for patterns up to 16chars (and for 32+KB haystacks, for 32--KB haystacks Railgun_Doublet takes over), it is to be used as backbone (along with Railgun_Quadruplet_7Hasherezade for patterns bigger than 16chars) of Railgun_r8_Mimino_x64.
*/
//
/*
Testbed: [File: OSHO.TXT 206,908,949 bytes; LinesEncountered: 2,459,508; Windows 7 64bit; E7500 2.93GHz dual DDR2]

Microsoft 2010 64bit compiler / Intel C++ 64 Compiler XE 12.1

Searching for Pattern('an',2bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 248KB/clock 238KB/clock
strstr_GNU_C_Library performance: 376KB/clock 296KB/clock
Railgun_Doublet performance: 421KB/clock 348KB/clock
BNDM_32 performance: 267KB/clock 241KB/clock

Searching for Pattern('to',2bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 260KB/clock 255KB/clock
strstr_GNU_C_Library performance: 400KB/clock 320KB/clock
Railgun_Doublet performance: 476KB/clock 397KB/clock
BNDM_32 performance: 290KB/clock 262KB/clock

Searching for Pattern('TDK',3bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 318KB/clock 323KB/clock
strstr_GNU_C_Library performance: 564KB/clock 421KB/clock
Railgun_Doublet performance: 551KB/clock 464KB/clock
BNDM_32 performance: 462KB/clock 409KB/clock

Searching for Pattern('the',3bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 233KB/clock 227KB/clock
strstr_GNU_C_Library performance: 346KB/clock 276KB/clock
Railgun_Doublet performance: 393KB/clock 328KB/clock
BNDM_32 performance: 255KB/clock 234KB/clock

Searching for Pattern('fast',4bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 311KB/clock 315KB/clock
strstr_GNU_C_Library performance: 540KB/clock 417KB/clock
Railgun_Doublet performance: 550KB/clock 463KB/clock
BNDM_32 performance: 390KB/clock 352KB/clock

Searching for Pattern('easy',4bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 258KB/clock 257KB/clock
strstr_GNU_C_Library performance: 395KB/clock 323KB/clock
Railgun_Doublet performance: 534KB/clock 452KB/clock
BNDM_32 performance: 379KB/clock 343KB/clock

Searching for Pattern('grmbl',5bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 309KB/clock 314KB/clock
strstr_GNU_C_Library performance: 535KB/clock 415KB/clock
Railgun_Doublet performance: 553KB/clock 465KB/clock
BNDM_32 performance: 451KB/clock 402KB/clock

Searching for Pattern('email',5bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 261KB/clock 260KB/clock
strstr_GNU_C_Library performance: 401KB/clock 326KB/clock
Railgun_Doublet performance: 550KB/clock 463KB/clock
BNDM_32 performance: 395KB/clock 359KB/clock

Searching for Pattern('pasting',7bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 311KB/clock 314KB/clock
strstr_GNU_C_Library performance: 542KB/clock 415KB/clock
Railgun_Doublet performance: 559KB/clock 469KB/clock
BNDM_32 performance: 400KB/clock 367KB/clock

Searching for Pattern('amazing',7bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 281KB/clock 282KB/clock
strstr_GNU_C_Library performance: 455KB/clock 367KB/clock
Railgun_Doublet performance: 557KB/clock 468KB/clock
BNDM_32 performance: 433KB/clock 392KB/clock

Searching for Pattern('underdog',8bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 300KB/clock 304KB/clock
strstr_GNU_C_Library performance: 510KB/clock 405KB/clock
Railgun_Doublet performance: 553KB/clock 464KB/clock
BNDM_32 performance: 419KB/clock 383KB/clock

Searching for Pattern('superdog',8bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 287KB/clock 288KB/clock
strstr_GNU_C_Library performance: 468KB/clock 378KB/clock
Railgun_Doublet performance: 562KB/clock 470KB/clock
BNDM_32 performance: 420KB/clock 384KB/clock

Searching for Pattern('participants',12bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 311KB/clock 315KB/clock
strstr_GNU_C_Library performance: 541KB/clock 415KB/clock
Railgun_Doublet performance: 568KB/clock 477KB/clock
BNDM_32 performance: 436KB/clock 398KB/clock

Searching for Pattern('skillessness',12bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 287KB/clock 289KB/clock
strstr_GNU_C_Library performance: 469KB/clock 378KB/clock
Railgun_Doublet performance: 573KB/clock 479KB/clock
BNDM_32 performance: 447KB/clock 407KB/clock

Searching for Pattern('I should have known',19bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 316KB/clock 320KB/clock
strstr_GNU_C_Library performance: 557KB/clock 418KB/clock
Railgun_Doublet performance: 587KB/clock 490KB/clock
BNDM_32 performance: 435KB/clock 400KB/clock

Searching for Pattern('human consciousness',19bytes) into String(206908949bytes) line-by-line ...

strstr_Microsoft performance: 291KB/clock 294KB/clock
strstr_GNU_C_Library performance: 482KB/clock 388KB/clock
Railgun_Doublet performance: 594KB/clock 494KB/clock
BNDM_32 performance: 441KB/clock 405KB/clock

Overview:

GNU Berg's performance (compiled with Microsoft 2010 64bit compiler): 376KB/clock+400KB/clock+564KB/clock+346KB/clock+540KB/clock+395KB/clock+535KB/clock+401KB/clock+542KB/clock+455KB/clock+510KB/clock+468KB/clock+541KB/clock+469KB/clock+557KB/clock+482KB/clock=7581
GNU Berg's performance (compiled with Intel C++ 64 Compiler XE 12.1): 296KB/clock+320KB/clock+421KB/clock+276KB/clock+417KB/clock+323KB/clock+415KB/clock+326KB/clock+415KB/clock+367KB/clock+405KB/clock+378KB/clock+415KB/clock+378KB/clock+418KB/clock+388KB/clock=5958

Railgun_Doublet performance (compiled with Microsoft 2010 64bit compiler): 421KB/clock+476KB/clock+551KB/clock+393KB/clock+550KB/clock+534KB/clock+553KB/clock+550KB/clock+559KB/clock+557KB/clock+553KB/clock+562KB/clock+568KB/clock+573KB/clock+587KB/clock+594KB/clock=8581
Railgun_Doublet performance (compiled with Intel C++ 64 Compiler XE 12.1): 348KB/clock+397KB/clock+464KB/clock+328KB/clock+463KB/clock+452KB/clock+465KB/clock+463KB/clock+469KB/clock+468KB/clock+464KB/clock+470KB/clock+477KB/clock+479KB/clock+490KB/clock+494KB/clock=7191

BNDM_32 performance (compiled with Microsoft 2010 64bit compiler): 267KB/clock+290KB/clock+462KB/clock+255KB/clock+390KB/clock+379KB/clock+451KB/clock+395KB/clock+400KB/clock+433KB/clock+419KB/clock+420KB/clock+436KB/clock+447KB/clock+435KB/clock+441KB/clock=6320
BNDM_32 performance (compiled with Intel C++ 64 Compiler XE 12.1): 241KB/clock+262KB/clock+409KB/clock+234KB/clock+352KB/clock+343KB/clock+402KB/clock+359KB/clock+367KB/clock+392KB/clock+383KB/clock+384KB/clock+398KB/clock+407KB/clock+400KB/clock+405KB/clock=5738

Summary for all 16 patterns:

GNU Berg's performance:      7581 Microsoft / 5958 Intel
Railgun_Doublet performance: 8581 Microsoft / 7191 Intel
BNDM_32 performance:         6320 Microsoft / 5738 Intel

Using Microsoft:
Railgun_Doublet is (8581-7581)/7581*100% = 13% faster than GNU Berg's
Railgun_Doublet is (8581-6320)/6320*100% = 35% faster than BNDM_32

Using Intel:
Railgun_Doublet is (7191-5958)/5958*100% = 20% faster than GNU Berg's
Railgun_Doublet is (7191-5738)/5738*100% = 25% faster than BNDM_32
*/
The C source(revision 6) follows:
// ### Mix(2in1) of Karp-Rabin & Boyer-Moore-Horspool algorithm [
// Caution: For better speed the case 'if (cbPattern==1)' was removed, so Pattern must be longer than 1 char.
char * Railgun_Quadruplet (char * pbTarget,
     char * pbPattern,
     unsigned long cbTarget,
     unsigned long cbPattern)
{
    char * pbTargetMax = pbTarget + cbTarget;
    register unsigned long  ulHashPattern;
    unsigned long ulHashTarget;
    unsigned long count;
    unsigned long countSTATIC;
//  unsigned long countRemainder;

/*
    const unsigned char SINGLET = *(char *)(pbPattern);
    const unsigned long Quadruplet2nd = SINGLET<<8;
    const unsigned long Quadruplet3rd = SINGLET<<16;
    const unsigned long Quadruplet4th = SINGLET<<24;
*/
    unsigned char SINGLET;
    unsigned long Quadruplet2nd;
    unsigned long Quadruplet3rd;
    unsigned long Quadruplet4th;

    unsigned long  AdvanceHopperGrass;

    long i; //BMH needed
    int a, j, bm_bc[ASIZE]; //BMH needed
    unsigned char ch; //BMH needed
//    unsigned char lastch, firstch; //BMH needed

    if (cbPattern > cbTarget)
        return(NULL);

// Doesn't work when cbPattern = 1
// The next IF-fragment works very well with cbPattern>1, OBVIOUSLY IT MUST BE UNROLLED(but crippled with less functionality) SINCE either cbPattern=2 or cbPattern=3!
if ( cbPattern<4) { // This IF makes me unhappy: it slows down from 390KB/clock to 367KB/clock for 'fast' pattern. This fragment(for 2..3 pattern lengths) is needed because I need a function different than strchr but sticking to strstr i.e. lengths above 1 are to be handled.
        pbTarget = pbTarget+cbPattern;
        ulHashPattern = ( (*(char *)(pbPattern))<<8 ) + *(pbPattern+(cbPattern-1));
        countSTATIC = cbPattern-2;

    for ( ;; )
    {
        // The line below gives for 'cbPattern'>=1:
        // Karp_Rabin_Kaze_4_OCTETS_hits/Karp_Rabin_Kaze_4_OCTETS_clocks: 4/543
        // Karp_Rabin_Kaze_4_OCTETS performance: 372KB/clock
/*
        if ( (ulHashPattern == ( (*(char *)(pbTarget-cbPattern))<<8 ) + *(pbTarget-1)) && !memcmp(pbPattern, pbTarget-cbPattern, (unsigned int)cbPattern) )
            return((long)(pbTarget-cbPattern));
*/

        // The fragment below gives for 'cbPattern'>=2:
        // Karp_Rabin_Kaze_4_OCTETS_hits/Karp_Rabin_Kaze_4_OCTETS_clocks: 4/546
        // Karp_Rabin_Kaze_4_OCTETS performance: 370KB/clock

        if ( ulHashPattern == ( (*(char *)(pbTarget-cbPattern))<<8 ) + *(pbTarget-1) ) {
         count = countSTATIC;
         while ( count && *(char *)(pbPattern+1+(countSTATIC-count)) == *(char *)(pbTarget-cbPattern+1+(countSTATIC-count)) ) {
               count--;
         }
         if ( count == 0) return((pbTarget-cbPattern));
        }

        // The fragment below gives for 'cbPattern'>=2:
	// Karp_Rabin_Kaze_4_OCTETS_hits/Karp_Rabin_Kaze_4_OCTETS_clocks: 4/554
	// Karp_Rabin_Kaze_4_OCTETS performance: 364KB/clock
/*
        if ( ulHashPattern == ( (*(char *)(pbTarget-cbPattern))<<8 ) + *(pbTarget-1) ) {
         count = countSTATIC>>2;
         countRemainder = countSTATIC % 4;

         while ( count && *(unsigned long *)(pbPattern+1+((count-1)<<2)) == *(unsigned long *)(pbTarget-cbPattern+1+((count-1)<<2)) ) {
               count--;
         }
	 //if (count == 0) {  // Disastrous degradation only from this line(317KB/clock when 1+2x4+2+1 bytes pattern: 'skillessness'; 312KB/clock when 1+1x4+2+1 bytes pattern: 'underdog'), otherwise 368KB/clock.
         while ( countRemainder && *(char *)(pbPattern+1+(countSTATIC-countRemainder)) == *(char *)(pbTarget-cbPattern+1+(countSTATIC-countRemainder)) ) {
               countRemainder--;
         }
         //if ( countRemainder == 0) return((long)(pbTarget-cbPattern));
         if ( count+countRemainder == 0) return((long)(pbTarget-cbPattern));
         //}
        }
*/

        pbTarget++;
        if (pbTarget > pbTargetMax)
            return(NULL);
    }
} else { //if ( cbPattern<4)
if (cbTarget<961) // This value is arbitrary(don't know how exactly), it ensures(at least must) better performance than 'Boyer_Moore_Horspool'.
{
        pbTarget = pbTarget+cbPattern;
        ulHashPattern = *(unsigned long *)(pbPattern);
        countSTATIC = cbPattern-1;

    //SINGLET = *(char *)(pbPattern);
    SINGLET = ulHashPattern & 0xFF;
    Quadruplet2nd = SINGLET<<8;
    Quadruplet3rd = SINGLET<<16;
    Quadruplet4th = SINGLET<<24;

    for ( ;; )
    {
	AdvanceHopperGrass = 0;
	ulHashTarget = *(unsigned long *)(pbTarget-cbPattern);

        if ( ulHashPattern == ulHashTarget ) { // Three unnecessary comparisons here, but 'AdvanceHopperGrass' must be calculated - it has a higher priority.
         count = countSTATIC;
         while ( count && *(char *)(pbPattern+1+(countSTATIC-count)) == *(char *)(pbTarget-cbPattern+1+(countSTATIC-count)) ) {
	       if ( countSTATIC==AdvanceHopperGrass+count && SINGLET != *(char *)(pbTarget-cbPattern+1+(countSTATIC-count)) ) AdvanceHopperGrass++;
               count--;
         }
         if ( count == 0) return((pbTarget-cbPattern));
        } else { // The goal here: to avoid memory accesses by stressing the registers.
    if ( Quadruplet2nd != (ulHashTarget & 0x0000FF00) ) {
         AdvanceHopperGrass++;
         if ( Quadruplet3rd != (ulHashTarget & 0x00FF0000) ) {
              AdvanceHopperGrass++;
              if ( Quadruplet4th != (ulHashTarget & 0xFF000000) ) AdvanceHopperGrass++;;
         }
    }
	}

	AdvanceHopperGrass++;

	pbTarget = pbTarget + AdvanceHopperGrass;
        if (pbTarget > pbTargetMax)
            return(NULL);
    }
} else { //if (cbTarget<961)
        countSTATIC = cbPattern-2;
    /* Preprocessing */
    for (a=0; a < ASIZE; a++) bm_bc[a]=cbPattern;
    for (j=0; j < cbPattern-1; j++) bm_bc[pbPattern[j]]=cbPattern-j-1;

    /* Searching */
    //lastch=pbPattern[cbPattern-1];
    //firstch=pbPattern[0];
    i=0;
    while (i <= cbTarget-cbPattern) {
       ch=pbTarget[i+cbPattern-1];
       //if (ch ==lastch)
          //if (memcmp(&pbTarget[i],pbPattern,cbPattern-1) == 0) OUTPUT(i);
          //if (ch == lastch && pbTarget[i] == firstch && memcmp(&pbTarget[i],pbPattern,cbPattern-1) == 0) return(i);  // Kaze: The idea(to prevent execution of slower 'memcmp') is borrowed from Karp-Rabin i.e. to perform a slower check only when the target "looks like".
          if (ch == pbPattern[cbPattern-1] && pbTarget[i] == pbPattern[0])
             {
         count = countSTATIC;
         while ( count && *(char *)(pbPattern+1+(countSTATIC-count)) == *(char *)(&pbTarget[i]+1+(countSTATIC-count)) ) {
               count--;
         }
         if ( count == 0) return(pbTarget+i);
	     }
       i+=bm_bc[ch];
    }
    return(NULL);
} //if (cbTarget<961)
} //if ( cbPattern<4)
}
// ### Mix(2in1) of Karp-Rabin & Boyer-Moore-Horspool algorithm ]
The C source(revision 7) follows:
// Caution: For better speed the case 'if (cbPattern==1)' was removed, so Pattern must be longer than 1 char.
char * Railgun_Quadruplet_7 (char * pbTarget, char * pbPattern, unsigned long cbTarget, unsigned long cbPattern)
{
	char * pbTargetMax = pbTarget + cbTarget;
	register unsigned long ulHashPattern;
	unsigned long ulHashTarget;
	signed long count;
	signed long countSTATIC;

	unsigned char SINGLET;
	unsigned long Quadruplet2nd;
	unsigned long Quadruplet3rd;
	unsigned long Quadruplet4th;
	unsigned long AdvanceHopperGrass;

	long i;
	int a, j, bm_bc[ASIZE];
	unsigned char ch;

	if (cbPattern > cbTarget) return(NULL);

	if (cbPattern<4) {
		pbTarget = pbTarget+cbPattern;
		ulHashPattern = ( (*(char *)(pbPattern))<<8 ) + *(pbPattern+(cbPattern-1));
		if (cbPattern==3) {
			for ( ;; ) {
				if ( ulHashPattern == ( (*(char *)(pbTarget-3))<<8 ) + *(pbTarget-1) ) {
					if ( *(char *)(pbPattern+1) == *(char *)(pbTarget-2) ) return((pbTarget-3));
				}
				if ( (char)(ulHashPattern>>8) != *(pbTarget-2) ) pbTarget++;
				pbTarget++;
	        		if (pbTarget > pbTargetMax) return(NULL);
    			}
		} else {
		}
			for ( ;; ) {
				if ( ulHashPattern == ( (*(char *)(pbTarget-2))<<8 ) + *(pbTarget-1) ) return((pbTarget-2));
				if ( (char)(ulHashPattern>>8) != *(pbTarget-1) ) pbTarget++;
				pbTarget++;
				if (pbTarget > pbTargetMax) return(NULL);
			}
	} else {
		if (cbTarget<961) {
			pbTarget = pbTarget+cbPattern;
			ulHashPattern = *(unsigned long *)(pbPattern);
			SINGLET = ulHashPattern & 0xFF;
			Quadruplet2nd = SINGLET<<8;
			Quadruplet3rd = SINGLET<<16;
			Quadruplet4th = SINGLET<<24;
			for ( ;; ) {
				AdvanceHopperGrass = 0;
				ulHashTarget = *(unsigned long *)(pbTarget-cbPattern);
				if ( ulHashPattern == ulHashTarget ) { 
					count = cbPattern-1;
					while ( count && *(char *)(pbPattern+(cbPattern-count)) == *(char *)(pbTarget-count) ) {
						if ( cbPattern-1==AdvanceHopperGrass+count && SINGLET != *(char *)(pbTarget-count) ) AdvanceHopperGrass++;
						count--;
					}
					if ( count == 0) return((pbTarget-cbPattern));
				} else {
					if ( Quadruplet2nd != (ulHashTarget & 0x0000FF00) ) {
						AdvanceHopperGrass++;
						if ( Quadruplet3rd != (ulHashTarget & 0x00FF0000) ) {
							AdvanceHopperGrass++;
							if ( Quadruplet4th != (ulHashTarget & 0xFF000000) ) AdvanceHopperGrass++;
						}
					}
				}
				AdvanceHopperGrass++;
				pbTarget = pbTarget + AdvanceHopperGrass;
				if (pbTarget > pbTargetMax) return(NULL);
			}
		} else {
			countSTATIC = cbPattern-2-2; 
			ulHashPattern = *(unsigned long *)(pbPattern);
			for (a=0; a < ASIZE; a++) bm_bc[a]=cbPattern;
			for (j=0; j < cbPattern-1; j++) bm_bc[pbPattern[j]]=cbPattern-j-1;
			i=0;
			while (i <= cbTarget-cbPattern) {
				if ( *(unsigned long *)&pbTarget[i] == ulHashPattern ) {
					count = countSTATIC;
					while ( count !=0 && *(char *)(pbPattern+1+3+(countSTATIC-count)) == *(char *)(&pbTarget[i]+1+3+(countSTATIC-count)) ) count--;
					if ( count == 0) return(pbTarget+i);
				}
				i= i + bm_bc[(unsigned char)pbTarget[i+cbPattern-1]];
			}
			return(NULL);
		}
	}
}
The C source(revision Railgun_Quadruplet_7Gulliver_count_hits) follows:
// ### Mix(2in1) of Karp-Rabin & Boyer-Moore-Sunday-Horspool algorithm [
/*
Tuning continues but the skeleton is built, I see 'Gulliver' as a really High-Performance etude.
And not to be empty-handed here the Gulliver's swiftness is benchmarked on String(206,908,949bytes) as-one-line:

Pattern: fast
Railgun_Quadruplet_7sun performance:      1057KB/clock / 456%, 45330622 skips/iterations
Railgun_Quadruplet_7 performance:         0976KB/clock / 377%, 54788054 skips/iterations
Railgun_Quadruplet_7sunhorse performance: 0649KB/clock / 480%, 43103056 skips/iterations
Railgun_Quadruplet_7deuce performance:    0564KB/clock / 389%, 53138919 skips/iterations
Railgun_Quadruplet_7Elsiane performance:  0505KB/clock / 551%, 37541955 skips/iterations
Railgun_Quadruplet_7Gulliver performance: 0780KB/clock / 300%, 68943184 skips/iterations
Boyer_Moore_Flensburg performance:        0486KB/clock / 377%, 54788139 skips/iterations

Pattern: faster
Railgun_Quadruplet_7sun performance:      1356KB/clock / 591%, 34996936 skips/iterations
Railgun_Quadruplet_7 performance:         1320KB/clock / 514%, 40194194 skips/iterations
Railgun_Quadruplet_7sunhorse performance: 0771KB/clock / 656%, 31504148 skips/iterations
Railgun_Quadruplet_7deuce performance:    0651KB/clock / 567%, 36434006 skips/iterations
Railgun_Quadruplet_7Elsiane performance:  0535KB/clock / 710%, 29101626 skips/iterations
Railgun_Quadruplet_7Gulliver performance: 1195KB/clock / 498%, 41544613 skips/iterations
Boyer_Moore_Flensburg performance:        0684KB/clock / 514%, 40194282 skips/iterations

Pattern: fastest
Railgun_Quadruplet_7sun performance:      1554KB/clock / 687%, 30084306 skips/iterations
Railgun_Quadruplet_7 performance:         1519KB/clock / 599%, 34540430 skips/iterations
Railgun_Quadruplet_7sunhorse performance: 0918KB/clock / 761%, 27188853 skips/iterations
Railgun_Quadruplet_7deuce performance:    0771KB/clock / 663%, 31175827 skips/iterations
Railgun_Quadruplet_7Elsiane performance:  0627KB/clock / 818%, 25281493 skips/iterations
Railgun_Quadruplet_7Gulliver performance: 1453KB/clock / 595%, 34744153 skips/iterations
Boyer_Moore_Flensburg performance:        0792KB/clock / 621%, 33278240 skips/iterations

Pattern: fastest fox
Railgun_Quadruplet_7sun performance:      1712KB/clock / 775%, 26672940 skips/iterations
Railgun_Quadruplet_7 performance:         1669KB/clock / 669%, 30925578 skips/iterations
Railgun_Quadruplet_7sunhorse performance: 0962KB/clock / 912%, 22663583 skips/iterations
Railgun_Quadruplet_7deuce performance:    0808KB/clock / 797%, 25945709 skips/iterations
Railgun_Quadruplet_7Elsiane performance:  0719KB/clock / 931%, 22213101 skips/iterations
Railgun_Quadruplet_7Gulliver performance: 2126KB/clock / 977%, 21166516 skips/iterations
Boyer_Moore_Flensburg performance:        1074KB/clock / 669%, 30925649 skips/iterations

Pattern: fastest fox with biggest strides
Railgun_Quadruplet_7sun performance:      2658KB/clock / 1584%, 13060463 skips/iterations
Railgun_Quadruplet_7 performance:         2767KB/clock / 1511%, 13689243 skips/iterations
Railgun_Quadruplet_7sunhorse performance: 1820KB/clock / 2138%, 09677267 skips/iterations
Railgun_Quadruplet_7deuce performance:    1669KB/clock / 2053%, 10075650 skips/iterations
Railgun_Quadruplet_7Elsiane performance:  1554KB/clock / 2143%, 09652548 skips/iterations
Railgun_Quadruplet_7Gulliver performance: 3157KB/clock / 2924%, 07074287 skips/iterations  Stratosphere-borne!
Boyer_Moore_Flensburg performance:        1836KB/clock / 1554%, 13307181 skips/iterations

Pattern: fastest fox with biggest strides known to me
Railgun_Quadruplet_7sun performance:      2590KB/clock / 1548%, 13363356 skips/iterations
Railgun_Quadruplet_7 performance:         2694KB/clock / 1447%, 14292419 skips/iterations
Railgun_Quadruplet_7sunhorse performance: 1924KB/clock / 2234%, 09259505 skips/iterations
Railgun_Quadruplet_7deuce performance:    1741KB/clock / 2011%, 10287584 skips/iterations
Railgun_Quadruplet_7Elsiane performance:  1683KB/clock / 2240%, 09236188 skips/iterations
Railgun_Quadruplet_7Gulliver performance: 3157KB/clock / 3832%, 05399116 skips/iterations  Mesosphere-borne!
Boyer_Moore_Flensburg performance:        1741KB/clock / 1540%, 13431751 skips/iterations

Pattern: fastest fox with biggest strides known to me up to 2012 January 26 namely 'Gulliver'
Railgun_Quadruplet_7sun performance:      3108KB/clock / 2890%, 07159321 skips/iterations
Railgun_Quadruplet_7 performance:         3108KB/clock / 2742%, 07545141 skips/iterations
Railgun_Quadruplet_7sunhorse performance: 2590KB/clock / 4138%, 04999777 skips/iterations
Railgun_Quadruplet_7deuce performance:    2464KB/clock / 4029%, 05135444 skips/iterations
Railgun_Quadruplet_7Elsiane performance:  2557KB/clock / 4141%, 04995463 skips/iterations
Railgun_Quadruplet_7Gulliver performance: 3157KB/clock / 7218%, 02866192 skips/iterations  Vacuum-borne!
Boyer_Moore_Flensburg performance:        2767KB/clock / 2745%, 07536097 skips/iterations
*/
// 
// Revision: 2, 2012-Jan-30, the main disadvantage: the preprocessing overhead.
// Caution: For better speed the case 'if (cbPattern==1)' was removed, so Pattern must be longer than 1 char.
// 
char * Railgun_Quadruplet_7Gulliver_count_hits (char * pbTarget, char * pbPattern, unsigned long cbTarget, unsigned long cbPattern)
{
	char * pbTargetMax = pbTarget + cbTarget;
	register unsigned long ulHashPattern;
	register unsigned long ulHashTarget;
	signed long count;
	signed long countSTATIC;

	unsigned char SINGLET;
	unsigned long Quadruplet2nd;
	unsigned long Quadruplet3rd;
	unsigned long Quadruplet4th;

	unsigned long  AdvanceHopperGrass;

	long i; //BMH needed
	int a, j;
	unsigned int bm_bc[256]; //BMH needed
	unsigned int bm_bc2nd[256]; //BMS needed
	unsigned char bm_Horspool_Order2[256*256]; //BMHSS(Elsiane) needed, 'char' limits patterns to 255, if 'long' then table becomes 256KB, grrr.
	unsigned long Gulliver; // or unsigned char or unsigned short

	if (cbPattern > cbTarget)
		return(NULL);

	if ( cbPattern<4) { 
		pbTarget = pbTarget+cbPattern;
		ulHashPattern = ( (*(char *)(pbPattern))<<8 ) + *(pbPattern+(cbPattern-1));

		if ( cbPattern==3) {
			for ( ;; ) {
				if ( ulHashPattern == ( (*(char *)(pbTarget-3))<<8 ) + *(pbTarget-1) ) {
					if ( *(char *)(pbPattern+1) == *(char *)(pbTarget-2) ) Railgunhits++; //return((pbTarget-3));
				}
				if ( (char)(ulHashPattern>>8) != *(pbTarget-2) ) pbTarget++;
				pbTarget++;
				if (pbTarget > pbTargetMax)
					return(NULL);
			}
		} else {
		}
		for ( ;; ) {
			if ( ulHashPattern == ( (*(char *)(pbTarget-2))<<8 ) + *(pbTarget-1) )
				Railgunhits++; //return((pbTarget-2));
			if ( (char)(ulHashPattern>>8) != *(pbTarget-1) ) pbTarget++;
			pbTarget++;
			if (pbTarget > pbTargetMax)
				return(NULL);
		}
	} else { //if ( cbPattern<4)
		if (cbTarget<961) { // This value is arbitrary(don't know how exactly), it ensures(at least must) better performance than 'Boyer_Moore_Horspool'.
/*
			// A better strstr, with no asm code
			// Written by Mischa Sandberg
			// http://mischasan.wordpress.com
			// static char const *
			// scanstrm(char const *tgt, char const *pat, int len)
			// {
			//     uint32_t head = MSBF32(pat), wind = 0, next;
			// 
			//     pat += 4, len -= 4;
			//     while ((next = *(uint8_t const*)tgt++)) {
			//         wind = ( wind << 8 ) + next;
			//         if (wind == head && !memcmp(tgt, pat, len))
			//             return tgt - 4;
			//     }
			//     return  NULL;
			//}
			ulHashPattern = 0;
			ulHashPattern = ( ulHashPattern << 8 ) + *(uint8_t const*)pbPattern++;
			ulHashPattern = ( ulHashPattern << 8 ) + *(uint8_t const*)pbPattern++;
			ulHashPattern = ( ulHashPattern << 8 ) + *(uint8_t const*)pbPattern++;
			ulHashPattern = ( ulHashPattern << 8 ) + *(uint8_t const*)pbPattern++;
			AdvanceHopperGrass = 0;
			cbPattern -= 4;
			while ((ulHashTarget = *(uint8_t const*)pbTarget++)) {
				AdvanceHopperGrass = ( AdvanceHopperGrass << 8 ) + ulHashTarget;
				if (AdvanceHopperGrass == ulHashPattern && !memcmp(pbTarget, pbPattern, cbPattern))
				Railgunhits++; //return pbTarget - 4;
			}
			return  NULL;
*/
			pbTarget = pbTarget+cbPattern;
			ulHashPattern = *(unsigned long *)(pbPattern);

			SINGLET = ulHashPattern & 0xFF;
			Quadruplet2nd = SINGLET<<8;
			Quadruplet3rd = SINGLET<<16;
			Quadruplet4th = SINGLET<<24;

			for ( ;; ) {
				AdvanceHopperGrass = 0;
				ulHashTarget = *(unsigned long *)(pbTarget-cbPattern);

			        if ( ulHashPattern == ulHashTarget ) { // Three unnecessary comparisons here, but 'AdvanceHopperGrass' must be calculated - it has a higher priority.
					count = cbPattern-1;
					while ( count && *(char *)(pbPattern+(cbPattern-count)) == *(char *)(pbTarget-count) ) {
						if ( cbPattern-1==AdvanceHopperGrass+count && SINGLET != *(char *)(pbTarget-count) ) AdvanceHopperGrass++;
						count--;
					}
					if ( count == 0) Railgunhits++; //return((pbTarget-cbPattern));
			        } else { // The goal here: to avoid memory accesses by stressing the registers.
					if ( Quadruplet2nd != (ulHashTarget & 0x0000FF00) ) {
						AdvanceHopperGrass++;
						if ( Quadruplet3rd != (ulHashTarget & 0x00FF0000) ) {
							AdvanceHopperGrass++;
							if ( Quadruplet4th != (ulHashTarget & 0xFF000000) ) AdvanceHopperGrass++;
						}
					}
				}

				AdvanceHopperGrass++;

				pbTarget = pbTarget + AdvanceHopperGrass;
				if (pbTarget > pbTargetMax)
					return(NULL);
			}
		} else { //if (cbTarget<961)
			countSTATIC = cbPattern-2-2;

			for (a=0; a < 256; a++) {bm_bc[a]=cbPattern; bm_bc2nd[a]=cbPattern+1;}
			for (j=0; j < cbPattern-1; j++) bm_bc[pbPattern[j]]=cbPattern-j-1; 
			for (j=0; j < cbPattern; j++) bm_bc2nd[pbPattern[j]]=cbPattern-j; 

			ulHashPattern = *(unsigned long *)(pbPattern); // First four bytes
			//ulHashTarget = *(unsigned short *)(pbPattern+cbPattern-1-1); // Last two bytes
		
			AdvanceHopperGrass = 0;
			i=0;

			// Elsiane r.2  [
			for (a=0; a < 256*256; a++) {bm_Horspool_Order2[a]= cbPattern-1;} // cbPattern-(Order-1) for Horspool; 'memset' if not optimized

			// alfalfa 7 long 6 BBs (al lf fa al lf fa) 3 distinct BBs (al lf fa) 
			// fast 4 0-1-2 fa as st
			for (j=0; j < cbPattern-1; j++) bm_Horspool_Order2[*(unsigned short *)(pbPattern+j)]=j; // Rightmost appearance/position is needed

			// Elsiane r.2 ]

			while (i <= cbTarget-cbPattern-1) { // -1 because Sunday is used
				Gulliver = bm_Horspool_Order2[*(unsigned short *)&pbTarget[i+cbPattern-1-1]];

				if ( Gulliver == cbPattern-2 ) { // CASE #1: means the pair (char order 2) is found
					if ( *(unsigned long *)&pbTarget[i] == ulHashPattern) {
						count = countSTATIC; // Last two chars already matched, to be fixed with -2
						while ( count !=0 && *(char *)(pbPattern+(countSTATIC-count)+4) == *(char *)(&pbTarget[i]+(countSTATIC-count)+4) )
							count--;
						if ( count == 0) Railgunhits++; //return(pbTarget+i);
					}
					//i = i + 1; // r.1, obviuosly this is the worst skip so turning to 'SunHorse': lines below
					if ( bm_bc[(unsigned char)pbTarget[i+cbPattern-1]] < bm_bc2nd[(unsigned char)pbTarget[i+(cbPattern)]] )
					         Gulliver =  bm_bc2nd[(unsigned char)pbTarget[i+(cbPattern)]];
					else
					         Gulliver =  bm_bc[(unsigned char)pbTarget[i+cbPattern-1]];
				} else if ( Gulliver != cbPattern-1 ) // CASE #2: if equal means the pair (char order 2) is not found i.e. Gulliver remains intact, skip the whole pattern and fall back (Order-1) chars i.e. one char for Order 2
					Gulliver = cbPattern - Gulliver - 2; // CASE #3: the pair is found and not as suffix i.e. rightmost position

				i = i + Gulliver;

// 32323218 Order 1 Horspool Skip-table A
// 01234568 Order 1 Horspool Skip-table B
// fa af fa af fa as st Order 2 Horspool Skip-table B
//  0  1  2  3  4  5  6
// HIKARIfast
// fafafast
//   fafafast +2 Order 1 'a' vs 't'
//   fafafast +2 = (cbPattern-SkipB-Order = 8-5-1 = 2) Order 1 'a' vs 't'
//   fafafast +2 = (cbPattern-SkipB-Order = 8-4-2 = 2) Order 2 'fa' vs 'st' i.e. CASE #3

// 76543218 Order 1 Horspool
// lo on ng gp pa ac ce Order 2 Horspool
//  0  1  2  3  4  5  6
// HIKARIfast
// longpace
//   longpace +2 Order 1 'a' vs 'e'
//        longpace +7 = (cbPattern-(Order-1) = 8-(2-1) = 7) Order 2 'fa' vs 'ce' i.e. CASE #2

				AdvanceHopperGrass++;
			}

			if (i == cbTarget-cbPattern) {
				if ( *(unsigned long *)&pbTarget[i] == ulHashPattern) {
					count = countSTATIC;
					while ( count !=0 && *(char *)(pbPattern+(countSTATIC-count)+4) == *(char *)(&pbTarget[i]+(countSTATIC-count)+4) )
						count--;
					if ( count == 0) Railgunhits++; //return(pbTarget+i);
				}
				AdvanceHopperGrass++;
			}

			GlobalSP += (int)((double)cbTarget/AdvanceHopperGrass*100);
			GlobalI += AdvanceHopperGrass;
			printf("Skip-Performance(bigger-the-better): %d%%, %d skips/iterations\n",(int)((double)cbTarget/AdvanceHopperGrass*100), AdvanceHopperGrass);
		
			return(NULL);
		} //if (cbTarget<961)
	} //if ( cbPattern<4)
}
// ### Mix(2in1) of Karp-Rabin & Boyer-Moore-Sunday-Horspool algorithm ]
The C source(revision Railgun_Quadruplet_7Hasherezade_count_hits) follows:
// ### Mix(2in1) of Karp-Rabin & Boyer-Moore-Sunday-Horspool algorithm [
// Scheherezade -> Hasherezade
// [Italian: buffa, feminine of buffo, comic.]
/*
First off: I am heavily disappointed from Speed-Performance of 'Hasherezade' and comparing Skip-Performance of 'Gulliver' and 'Hasherezade' doesn't make me happy, either.

Pattern: fastest fox
Doing Search for Pattern(11bytes) into String(206908949bytes) as-one-line ...

Railgun_Quadruplet_7sun performance:         1,683KB/clock / 00,775%, 26,672,940 skips/iterations
Railgun_Quadruplet_7 performance:            1,642KB/clock / 00,669%, 30,925,578 skips/iterations
Railgun_Quadruplet_7sunhorse performance:    0,944KB/clock / 00,912%, 22,663,583 skips/iterations
Railgun_Quadruplet_7deuce performance:       0,801KB/clock / 00,797%, 25,945,709 skips/iterations
Railgun_Quadruplet_7Elsiane performance:     0,704KB/clock / 00,931%, 22,213,101 skips/iterations
Railgun_Quadruplet_7Gulliver performance:    2,104KB/clock / 00,977%, 21,166,516 skips/iterations
Railgun_Quadruplet_7Hasherezade performance: 1,496KB/clock / 00,980%, 21,112,657 skips/iterations  18bit HashTable
Railgun_Quadruplet_7Hasherezade performance: 1,642KB/clock / 00,980%, 21,112,646 skips/iterations  14bit HashTable
Railgun_Quadruplet_7Hasherezade performance: 1,642KB/clock / 00,980%, 21,112,735 skips/iterations  10bit HashTable
Boyer_Moore_Flensburg performance:           1,057KB/clock / 00,669%, 30,925,578 skips/iterations

Pattern: and every day a continuous cleaning goes on
Doing Search for Pattern(43bytes) into String(206908949bytes) as-one-line ...

Railgun_Quadruplet_7sun performance:         2,557KB/clock / 01,495%, 13,832,201 skips/iterations
Railgun_Quadruplet_7 performance:            2,590KB/clock / 01,404%, 14,731,326 skips/iterations
Railgun_Quadruplet_7sunhorse performance:    1,888KB/clock / 02,222%, 09,308,136 skips/iterations
Railgun_Quadruplet_7deuce performance:       1,741KB/clock / 01,971%, 10,494,460 skips/iterations
Railgun_Quadruplet_7Elsiane performance:     1,642KB/clock / 02,229%, 09,279,871 skips/iterations
Railgun_Quadruplet_7Gulliver performance:    3,157KB/clock / 03,795%, 05,450,890 skips/iterations
Railgun_Quadruplet_7Hasherezade performance: 2,322KB/clock / 04,100%, 05,046,049 skips/iterations  18bit HashTable
Railgun_Quadruplet_7Hasherezade performance: 2,971KB/clock / 04,100%, 05,046,445 skips/iterations  14bit HashTable
Railgun_Quadruplet_7Hasherezade performance: 3,015KB/clock / 04,090%, 05,058,667 skips/iterations  10bit HashTable
Boyer_Moore_Flensburg performance:           1,683KB/clock / 01,447%, 14,294,963 skips/iterations

Pattern: And let this be your very fundamental insight... about everything. Just for one year, don't choose.
Doing Search for Pattern(99bytes) into String(206908949bytes) as-one-line ...

Railgun_Quadruplet_7sun performance:         2,845KB/clock / 02,248%, 09,200,917 skips/iterations
Railgun_Quadruplet_7 performance:            2,928KB/clock / 02,105%, 09,827,389 skips/iterations
Railgun_Quadruplet_7sunhorse performance:    2,270KB/clock / 03,283%, 06,302,096 skips/iterations
Railgun_Quadruplet_7deuce performance:       2,149KB/clock / 03,196%, 06,472,407 skips/iterations
Railgun_Quadruplet_7Elsiane performance:     2,172KB/clock / 03,282%, 06,303,154 skips/iterations
Railgun_Quadruplet_7Gulliver performance:    2,928KB/clock / 07,820%, 02,645,814 skips/iterations
Railgun_Quadruplet_7Hasherezade performance: 2,494KB/clock / 09,575%, 02,160,890 skips/iterations  18bit HashTable
Railgun_Quadruplet_7Hasherezade performance: 3,015KB/clock / 09,568%, 02,162,493 skips/iterations  14bit HashTable
Railgun_Quadruplet_7Hasherezade performance: 3,015KB/clock / 09,438%, 02,192,204 skips/iterations  10bit HashTable
Boyer_Moore_Flensburg performance:           2,349KB/clock / 02,135%, 09,689,008 skips/iterations

Pattern: Then, singing among the savage branches, it impales itself upon the longest, sharpest spine. And, dying, it rises above its own agony to outcarol the lark and the nightingale.
Doing Search for Pattern(175bytes) into String(206908949bytes) as-one-line ...

Railgun_Quadruplet_7sun performance:         2,658KB/clock / 03,142%, 06,583,682 skips/iterations
Railgun_Quadruplet_7 performance:            2,658KB/clock / 03,095%, 06,685,179 skips/iterations
Railgun_Quadruplet_7sunhorse performance:    2,377KB/clock / 04,776%, 04,331,865 skips/iterations
Railgun_Quadruplet_7deuce performance:       2,349KB/clock / 04,728%, 04,376,097 skips/iterations
Railgun_Quadruplet_7Elsiane performance:     2,525KB/clock / 04,778%, 04,330,200 skips/iterations
Railgun_Quadruplet_7Gulliver performance:    2,245KB/clock / 12,024%, 01,720,711 skips/iterations
Railgun_Quadruplet_7Hasherezade performance: 2,434KB/clock / 17,127%, 01,208,072 skips/iterations  18bit HashTable
Railgun_Quadruplet_7Hasherezade performance: 2,590KB/clock / 17,084%, 01,211,064 skips/iterations  14bit HashTable
Railgun_Quadruplet_7Hasherezade performance: 2,590KB/clock / 16,379%, 01,263,238 skips/iterations  10bit HashTable
Boyer_Moore_Flensburg performance:           2,525KB/clock / 03,198%, 06,469,280 skips/iterations  Five times more main-cycles and faster than 'Hasherezade', pshaw!
*/
#define ROL(x, n) (((x) << (n)) | ((x) >> (32-(n))))
#define HashTableSize 18
// Revision: 1, 2012-Feb-01, the main disadvantage: the preprocessing overhead PLUS a hasher.
// Caution: For better speed the case 'if (cbPattern==1)' was removed, so Pattern must be longer than 1 char.
char * Railgun_Quadruplet_7Hasherezade_count_hits (char * pbTarget, char * pbPattern, unsigned long cbTarget, unsigned long cbPattern)
{
	char * pbTargetMax = pbTarget + cbTarget;
	register unsigned long ulHashPattern;
	register unsigned long ulHashTarget;
	signed long count;
	signed long countSTATIC;

	unsigned char SINGLET;
	unsigned long Quadruplet2nd;
	unsigned long Quadruplet3rd;
	unsigned long Quadruplet4th;

	unsigned long  AdvanceHopperGrass;

	long i; //BMH needed
	int a, j;
	unsigned int bm_bc[256]; //BMH needed
	unsigned int bm_bc2nd[256]; //BMS needed
	unsigned char bm_Horspool_Order2[256*256]; //BMHSS(Elsiane) needed, 'char' limits patterns to 255, if 'long' then table becomes 256KB, grrr.
	unsigned char bm_Hasherezade_HASH[1<<(HashTableSize)]; // Jesteressing 8bytes (Horspool Order 8) for fast lookup, should be bitwise (i.e. 8times smaller) since it says yes/no for presence.
	uint32_t hash32;
	unsigned long Gulliver; // or unsigned char or unsigned short

	if (cbPattern > cbTarget)
		return(NULL);

	if ( cbPattern<4) { 
		pbTarget = pbTarget+cbPattern;
		ulHashPattern = ( (*(char *)(pbPattern))<<8 ) + *(pbPattern+(cbPattern-1));

		if ( cbPattern==3) {
			for ( ;; ) {
				if ( ulHashPattern == ( (*(char *)(pbTarget-3))<<8 ) + *(pbTarget-1) ) {
					if ( *(char *)(pbPattern+1) == *(char *)(pbTarget-2) ) Railgunhits++; //return((pbTarget-3));
				}
				if ( (char)(ulHashPattern>>8) != *(pbTarget-2) ) pbTarget++;
				pbTarget++;
				if (pbTarget > pbTargetMax)
					return(NULL);
			}
		} else {
		}
		for ( ;; ) {
			if ( ulHashPattern == ( (*(char *)(pbTarget-2))<<8 ) + *(pbTarget-1) )
				Railgunhits++; //return((pbTarget-2));
			if ( (char)(ulHashPattern>>8) != *(pbTarget-1) ) pbTarget++;
			pbTarget++;
			if (pbTarget > pbTargetMax)
				return(NULL);
		}
	} else { //if ( cbPattern<4)
		if (cbTarget<961) { // This value is arbitrary(don't know how exactly), it ensures(at least must) better performance than 'Boyer_Moore_Horspool'.
/*
			// A better strstr, with no asm code
			// Written by Mischa Sandberg
			// http://mischasan.wordpress.com
			// static char const *
			// scanstrm(char const *tgt, char const *pat, int len)
			// {
			//     uint32_t head = MSBF32(pat), wind = 0, next;
			// 
			//     pat += 4, len -= 4;
			//     while ((next = *(uint8_t const*)tgt++)) {
			//         wind = ( wind << 8 ) + next;
			//         if (wind == head && !memcmp(tgt, pat, len))
			//             return tgt - 4;
			//     }
			//     return  NULL;
			//}
			ulHashPattern = 0;
			ulHashPattern = ( ulHashPattern << 8 ) + *(uint8_t const*)pbPattern++;
			ulHashPattern = ( ulHashPattern << 8 ) + *(uint8_t const*)pbPattern++;
			ulHashPattern = ( ulHashPattern << 8 ) + *(uint8_t const*)pbPattern++;
			ulHashPattern = ( ulHashPattern << 8 ) + *(uint8_t const*)pbPattern++;
			AdvanceHopperGrass = 0;
			cbPattern -= 4;
			while ((ulHashTarget = *(uint8_t const*)pbTarget++)) {
				AdvanceHopperGrass = ( AdvanceHopperGrass << 8 ) + ulHashTarget;
				if (AdvanceHopperGrass == ulHashPattern && !memcmp(pbTarget, pbPattern, cbPattern))
				Railgunhits++; //return pbTarget - 4;
			}
			return  NULL;
*/
			pbTarget = pbTarget+cbPattern;
			ulHashPattern = *(unsigned long *)(pbPattern);

			SINGLET = ulHashPattern & 0xFF;
			Quadruplet2nd = SINGLET<<8;
			Quadruplet3rd = SINGLET<<16;
			Quadruplet4th = SINGLET<<24;

			for ( ;; ) {
				AdvanceHopperGrass = 0;
				ulHashTarget = *(unsigned long *)(pbTarget-cbPattern);

			        if ( ulHashPattern == ulHashTarget ) { // Three unnecessary comparisons here, but 'AdvanceHopperGrass' must be calculated - it has a higher priority.
					count = cbPattern-1;
					while ( count && *(char *)(pbPattern+(cbPattern-count)) == *(char *)(pbTarget-count) ) {
						if ( cbPattern-1==AdvanceHopperGrass+count && SINGLET != *(char *)(pbTarget-count) ) AdvanceHopperGrass++;
						count--;
					}
					if ( count == 0) Railgunhits++; //return((pbTarget-cbPattern));
			        } else { // The goal here: to avoid memory accesses by stressing the registers.
					if ( Quadruplet2nd != (ulHashTarget & 0x0000FF00) ) {
						AdvanceHopperGrass++;
						if ( Quadruplet3rd != (ulHashTarget & 0x00FF0000) ) {
							AdvanceHopperGrass++;
							if ( Quadruplet4th != (ulHashTarget & 0xFF000000) ) AdvanceHopperGrass++;
						}
					}
				}

				AdvanceHopperGrass++;

				pbTarget = pbTarget + AdvanceHopperGrass;
				if (pbTarget > pbTargetMax)
					return(NULL);
			}
		} else { //if (cbTarget<961)
			countSTATIC = cbPattern-2-2;

			for (a=0; a < 256; a++) {bm_bc[a]=cbPattern; bm_bc2nd[a]=cbPattern+1;}
			for (j=0; j < cbPattern-1; j++) bm_bc[pbPattern[j]]=cbPattern-j-1; 
			for (j=0; j < cbPattern; j++) bm_bc2nd[pbPattern[j]]=cbPattern-j; 

			ulHashPattern = *(unsigned long *)(pbPattern); // First four bytes
			//ulHashTarget = *(unsigned short *)(pbPattern+cbPattern-1-1); // Last two bytes
		
			AdvanceHopperGrass = 0;
			i=0;

			// Elsiane r.2  [
			for (a=0; a < 256*256; a++) {bm_Horspool_Order2[a]= cbPattern-1;} // cbPattern-(Order-1) for Horspool; 'memset' if not optimized

			// alfalfa 7 long 6 BBs (al lf fa al lf fa) 3 distinct BBs (al lf fa) 
			// fast 4 0-1-2 fa as st
			for (j=0; j < cbPattern-1; j++) bm_Horspool_Order2[*(unsigned short *)(pbPattern+j)]=j; // Rightmost appearance/position is needed

			// Elsiane r.2  ]

	if ( cbPattern>10) { 
			// Hasherezade r.1 [
			// OSHO.TXT has 00,046,486 03bytes distinct BBs
			// OSHO.TXT has 00,248,019 04bytes distinct BBs
			// OSHO.TXT has 00,855,682 05bytes distinct BBs
			// OSHO.TXT has 02,236,138 06bytes distinct BBs
			// OSHO.TXT has 04,803,152 07bytes distinct BBs
			// OSHO.TXT has 08,956,496 08bytes distinct BBs to be hashed in 18bit i.e. 256KB i.e. 262,144 slots i.e. 34 vs 1.
			// OSHO.TXT has 15,006,172 09bytes distinct BBs
			// OSHO.TXT has 22,992,127 10bytes distinct BBs
			// Note: BB stands for Building-Block (also suffix)

			for (a=0; a < 1<<(HashTableSize); a++) {bm_Hasherezade_HASH[a]= 0;} // to-do: bit to replace byte; 'memset' if not optimized
			// cbPattern - Order + 1 i.e. number of BBs for 11 'fastest fox' 11-8+1=4: 'fastest ', 'astest f', 'stest fo', 'test fox'
			for (j=0; j < cbPattern-8+1; j++) {
				hash32 = (2166136261 ^ (ROL(*(uint32_t *)(pbPattern+j),5)^*(uint32_t *)(pbPattern+j+4))) * 709607;        
				bm_Hasherezade_HASH[( hash32 ^ (hash32 >> 16) ) & ( (1<<(HashTableSize))-1 )]=1;
/*
for (a=0; a<8; a++)
printf("%c",*(char *)(pbPattern+j+a) );
printf(" %lu\n",( hash32 ^ (hash32 >> 16) ) & ( (1<<(HashTableSize))-1 ));
//Input Pattern(up to 19+2000 chars): and every day a continuous cleaning goes on
//Doing Search for Pattern(43bytes) into String(206908949bytes) as-one-line ...
BBs      Slot(HashCode for 18bit HashTable)
and ever 117013
nd every 108604
d every  155516
 every d 170959
every da 115291
very day 73191
ery day  97042
ry day a 83793
y day a  11244
 day a c 115855
day a co 101797
ay a con 222568
y a cont 29130
 a conti 20978
a contin 258405
 continu 252691
continuo 123607
ontinuou 56546
ntinuous 135857
tinuous  15332
inuous c 250584
nuous cl 48224
uous cle 106616
ous clea 137020
us clean 35751
s cleani 178989
 cleanin 213855
cleaning 63337
leaning  97138
eaning g 62366
aning go 247590
ning goe 36571
ing goes 41142
ng goes  228365
g goes o 229696
 goes on 176852
*/
			}
			// Hasherezade r.1 ]

			while (i <= cbTarget-cbPattern-1) { // -1 because Sunday is used
				Gulliver = bm_Horspool_Order2[*(unsigned short *)&pbTarget[i+cbPattern-1-1]];

				if ( Gulliver == cbPattern-2 ) { // CASE #1: means the pair (char order 2) is found
					if ( *(unsigned long *)&pbTarget[i] == ulHashPattern) {
						count = countSTATIC; // Last two chars already matched, to be fixed with -2
						while ( count !=0 && *(char *)(pbPattern+(countSTATIC-count)+4) == *(char *)(&pbTarget[i]+(countSTATIC-count)+4) )
							count--;
						if ( count == 0) Railgunhits++; //return(pbTarget+i);
					}
					//i = i + 1; // r.1, obviuosly this is the worst skip so turning to 'SunHorse': lines below
					if ( bm_bc[(unsigned char)pbTarget[i+cbPattern-1]] < bm_bc2nd[(unsigned char)pbTarget[i+(cbPattern)]] )
					         Gulliver =  bm_bc2nd[(unsigned char)pbTarget[i+(cbPattern)]];
					else
					         Gulliver =  bm_bc[(unsigned char)pbTarget[i+cbPattern-1]];
				} else if ( Gulliver != cbPattern-1 ) // CASE #2: if equal means the pair (char order 2) is not found i.e. Gulliver remains intact, skip the whole pattern and fall back (Order-1) chars i.e. one char for Order 2
					Gulliver = cbPattern - Gulliver - 2; // CASE #3: the pair is found and not as suffix i.e. rightmost position
			
				// The goal: to jump when the rightmost 8bytes (Order 8 Horspool) of window do not look like any of Needle prefixes i.e. are not to be found. This maximum jump equals cbPattern-(Order-1) or 11-(8-1)=4 for 'fastest fox' - a small one but for Needle 31 bytes the jump equals 31-(8-1)=24
				if (Gulliver < cbPattern-(8-1)) { 
					hash32 = (2166136261 ^ (ROL(*(uint32_t *)(pbTarget+i+cbPattern-8),5)^*(uint32_t *)(pbTarget+i+cbPattern-8+4))) * 709607;        
					if ( bm_Hasherezade_HASH[( hash32 ^ (hash32 >> 16) ) & ( (1<<(HashTableSize))-1 )]==0 )
						Gulliver = cbPattern-(8-1);
				}
					i = i + Gulliver;
				AdvanceHopperGrass++;
/*
; 4155 : 				// The goal: to jump when the rightmost 8bytes (Order 8 Horspool) of window do not look like any of Needle prefixes i.e. are not to be found. This maximum jump equals cbPattern-(Order-1) or 11-(8-1)=4 for 'fastest fox' - a small one but for Needle 31 bytes the jump equals 31-(8-1)=24
; 4156 : 				if (Gulliver < cbPattern-(8-1)) { 

  01f16	8d 43 f9	 lea	 eax, DWORD PTR [ebx-7]
  01f19	3b c8		 cmp	 ecx, eax
  01f1b	73 30		 jae	 SHORT $LN18@Railgun_Qu@8

; 4157 : 					hash32 = (2166136261 ^ (ROL(*(uint32_t *)(pbTarget+i+cbPattern-8),5)^*(uint32_t *)(pbTarget+i+cbPattern-8+4))) * 709607;        

  01f1d	8b 44 32 f8	 mov	 eax, DWORD PTR [edx+esi-8]
  01f21	c1 c0 05	 rol	 eax, 5
  01f24	33 44 32 fc	 xor	 eax, DWORD PTR [edx+esi-4]
  01f28	35 c5 9d 1c 81	 xor	 eax, -2128831035	; 811c9dc5H
  01f2d	69 c0 e7 d3 0a
	00		 imul	 eax, 709607		; 000ad3e7H

; 4158 : 					if ( bm_Hasherezade_HASH[( hash32 ^ (hash32 >> 16) ) & ( (1<<(HashTableSize))-1 )]==0 )

  01f33	8b f8		 mov	 edi, eax
  01f35	c1 ef 10	 shr	 edi, 16			; 00000010H
  01f38	33 f8		 xor	 edi, eax
  01f3a	81 e7 ff ff 03
	00		 and	 edi, 262143		; 0003ffffH
  01f40	80 bc 3c 28 08
	01 00 00	 cmp	 BYTE PTR _bm_Hasherezade_HASH$[esp+edi+329776], 0
  01f48	75 03		 jne	 SHORT $LN18@Railgun_Qu@8

; 4159 : 						Gulliver = cbPattern-(8-1);

  01f4a	8d 4b f9	 lea	 ecx, DWORD PTR [ebx-7]
$LN18@Railgun_Qu@8:

; 4160 : 				}
; 4161 : 					i = i + Gulliver;
; 4162 : 				AdvanceHopperGrass++;
*/
			}

	} else {
			while (i <= cbTarget-cbPattern-1) { // -1 because Sunday is used
				Gulliver = bm_Horspool_Order2[*(unsigned short *)&pbTarget[i+cbPattern-1-1]];

				if ( Gulliver == cbPattern-2 ) { // CASE #1: means the pair (char order 2) is found
					if ( *(unsigned long *)&pbTarget[i] == ulHashPattern) {
						count = countSTATIC; // Last two chars already matched, to be fixed with -2
						while ( count !=0 && *(char *)(pbPattern+(countSTATIC-count)+4) == *(char *)(&pbTarget[i]+(countSTATIC-count)+4) )
							count--;
						if ( count == 0) Railgunhits++; //return(pbTarget+i);
					}
					//i = i + 1; // r.1, obviuosly this is the worst skip so turning to 'SunHorse': lines below
					if ( bm_bc[(unsigned char)pbTarget[i+cbPattern-1]] < bm_bc2nd[(unsigned char)pbTarget[i+(cbPattern)]] )
					         Gulliver =  bm_bc2nd[(unsigned char)pbTarget[i+(cbPattern)]];
					else
					         Gulliver =  bm_bc[(unsigned char)pbTarget[i+cbPattern-1]];
				} else if ( Gulliver != cbPattern-1 ) // CASE #2: if equal means the pair (char order 2) is not found i.e. Gulliver remains intact, skip the whole pattern and fall back (Order-1) chars i.e. one char for Order 2
					Gulliver = cbPattern - Gulliver - 2; // CASE #3: the pair is found and not as suffix i.e. rightmost position

				i = i + Gulliver;

// 32323218 Order 1 Horspool Skip-table A
// 01234568 Order 1 Horspool Skip-table B
// fa af fa af fa as st Order 2 Horspool Skip-table B
//  0  1  2  3  4  5  6
// HIKARIfast
// fafafast
//   fafafast +2 Order 1 'a' vs 't'
//   fafafast +2 = (cbPattern-SkipB-Order = 8-5-1 = 2) Order 1 'a' vs 't'
//   fafafast +2 = (cbPattern-SkipB-Order = 8-4-2 = 2) Order 2 'fa' vs 'st' i.e. CASE #3

// 76543218 Order 1 Horspool
// lo on ng gp pa ac ce Order 2 Horspool
//  0  1  2  3  4  5  6
// HIKARIfast
// longpace
//   longpace +2 Order 1 'a' vs 'e'
//        longpace +7 = (cbPattern-(Order-1) = 8-(2-1) = 7) Order 2 'fa' vs 'ce' i.e. CASE #2

				AdvanceHopperGrass++;
			}
	} //if ( cbPattern>10) { 

			if (i == cbTarget-cbPattern) {
				if ( *(unsigned long *)&pbTarget[i] == ulHashPattern) {
					count = countSTATIC;
					while ( count !=0 && *(char *)(pbPattern+(countSTATIC-count)+4) == *(char *)(&pbTarget[i]+(countSTATIC-count)+4) )
						count--;
					if ( count == 0) Railgunhits++; //return(pbTarget+i);
				}
				AdvanceHopperGrass++;
			}

			GlobalSP += (int)((double)cbTarget/AdvanceHopperGrass*100);
			GlobalI += AdvanceHopperGrass;
			printf("Skip-Performance(bigger-the-better): %d%%, %d skips/iterations\n",(int)((double)cbTarget/AdvanceHopperGrass*100), AdvanceHopperGrass);
		
			return(NULL);
		} //if (cbTarget<961)
	} //if ( cbPattern<4)
}
// ### Mix(2in1) of Karp-Rabin & Boyer-Moore-Sunday-Horspool algorithm ]

Below is the results regarding speed of Heavy-Search-Hustle dump:
Intel Merom 2166MHz Intel Reserved AMD Reserved
32bit Compiler:
Microsoft 16.00.30319.01
32bit Compiler:
Intel 11.1
Revision 6Revision 6+Revision 6
strstr_Microsoft 'an': 172KB/clock 'an': 168KB/clock'an': 147KB/clock
strstr_GNU_C_Library 'an': 279KB/clock 'an': 268KB/clock'an': 268KB/clock
Railgun 'an': 262KB/clock 'an': 248KB/clock'an': 257KB/clock
Railgun_Quadruplet 'an': 265KB/clock 'an': 315KB/clock'an': 279KB/clock
strstr_Microsoft 'to': 179KB/clock 'to': 175KB/clock'to': 152KB/clock
strstr_GNU_C_Library 'to': 297KB/clock 'to': 288KB/clock'to': 285KB/clock
Railgun 'to': 294KB/clock 'to': 279KB/clock'to': 292KB/clock
Railgun_Quadruplet 'to': 297KB/clock 'to': 349KB/clock'to': 310KB/clock
strstr_Microsoft 'TDK': 214KB/clock 'TDK': 210KB/clock'TDK': 178KB/clock
strstr_GNU_C_Library 'TDK': 411KB/clock 'TDK': 398KB/clock'TDK': 375KB/clock
Railgun 'TDK': 339KB/clock 'TDK': 330KB/clock'TDK': 340KB/clock
Railgun_Quadruplet 'TDK': 341KB/clock 'TDK': 424KB/clock'TDK': 350KB/clock
strstr_Microsoft 'the': 164KB/clock 'the': 160KB/clock'the': 141KB/clock
strstr_GNU_C_Library 'the': 256KB/clock 'the': 247KB/clock'the': 244KB/clock
Railgun 'the': 262KB/clock 'the': 253KB/clock'the': 261KB/clock
Railgun_Quadruplet 'the': 263KB/clock 'the': 285KB/clock'the': 271KB/clock
strstr_Microsoft 'fast': 210KB/clock 'fast': 206KB/clock'fast': 175KB/clock
strstr_GNU_C_Library 'fast': 396KB/clock 'fast': 386KB/clock'fast': 375KB/clock
Railgun 'fast': 339KB/clock 'fast': 330KB/clock'fast': 339KB/clock
Railgun_Quadruplet 'fast': 395KB/clock 'fast': 398KB/clock'fast': 382KB/clock
strstr_Microsoft 'easy': 177KB/clock 'easy': 174KB/clock'easy': 152KB/clock
strstr_GNU_C_Library 'easy': 296KB/clock 'easy': 289KB/clock'easy': 281KB/clock
Railgun 'easy': 337KB/clock 'easy': 329KB/clock'easy': 339KB/clock
Railgun_Quadruplet 'easy': 302KB/clock 'easy': 300KB/clock'easy': 298KB/clock
strstr_Microsoft 'grmbl': 209KB/clock 'grmbl': 206KB/clock'grmbl': 175KB/clock
strstr_GNU_C_Library 'grmbl': 393KB/clock 'grmbl': 382KB/clock'grmbl': 375KB/clock
Railgun 'grmbl': 341KB/clock 'grmbl': 333KB/clock'grmbl': 344KB/clock
Railgun_Quadruplet 'grmbl': 395KB/clock 'grmbl': 397KB/clock'grmbl': 383KB/clock
strstr_Microsoft 'email': 178KB/clock 'email': 175KB/clock'email': 152KB/clock
strstr_GNU_C_Library 'email': 301KB/clock 'email': 293KB/clock'email': 285KB/clock
Railgun 'email': 338KB/clock 'email': 329KB/clock'email': 340KB/clock
Railgun_Quadruplet 'email': 303KB/clock 'email': 301KB/clock'email': 299KB/clock
strstr_Microsoft 'pasting': 210KB/clock 'pasting': 207KB/clock'pasting': 175KB/clock
strstr_GNU_C_Library 'pasting': 396KB/clock 'pasting': 386KB/clock'pasting': 374KB/clock
Railgun 'pasting': 346KB/clock 'pasting': 338KB/clock'pasting': 347KB/clock
Railgun_Quadruplet 'pasting': 401KB/clock 'pasting': 404KB/clock'pasting': 389KB/clock
strstr_Microsoft 'amazing': 191KB/clock 'amazing': 188KB/clock'amazing': 162KB/clock
strstr_GNU_C_Library 'amazing': 338KB/clock 'amazing': 329KB/clock'amazing': 327KB/clock
Railgun 'amazing': 345KB/clock 'amazing': 337KB/clock'amazing': 347KB/clock
Railgun_Quadruplet 'amazing': 347KB/clock 'amazing': 347KB/clock'amazing': 340KB/clock
strstr_Microsoft 'underdog': 203KB/clock 'underdog': 200KB/clock'underdog': 170KB/clock
strstr_GNU_C_Library 'underdog': 376KB/clock 'underdog': 366KB/clock'underdog': 363KB/clock
Railgun 'underdog': 348KB/clock 'underdog': 339KB/clock'underdog': 350KB/clock
Railgun_Quadruplet 'underdog': 385KB/clock 'underdog': 389KB/clock'underdog': 376KB/clock
strstr_Microsoft 'superdog': 195KB/clock 'superdog': 191KB/clock'superdog': 164KB/clock
strstr_GNU_C_Library 'superdog': 347KB/clock 'superdog': 337KB/clock'superdog': 335KB/clock
Railgun 'superdog': 347KB/clock 'superdog': 338KB/clock'superdog': 348KB/clock
Railgun_Quadruplet 'superdog': 355KB/clock 'superdog': 356KB/clock'superdog': 348KB/clock
strstr_Microsoft 'participants': 210KB/clock 'participants': 206KB/clock'participants': 175KB/clock
strstr_GNU_C_Library 'participants': 396KB/clock 'participants': 386KB/clock'participants': 373KB/clock
Railgun 'participants': 355KB/clock 'participants': 346KB/clock'participants': 357KB/clock
Railgun_Quadruplet 'participants': 411KB/clock 'participants': 415KB/clock'participants': 400KB/clock
strstr_Microsoft 'skillessness': 195KB/clock 'skillessness': 192KB/clock'skillessness': 164KB/clock
strstr_GNU_C_Library 'skillessness': 348KB/clock 'skillessness': 338KB/clock'skillessness': 336KB/clock
Railgun 'skillessness': 352KB/clock 'skillessness': 340KB/clock'skillessness': 353KB/clock
Railgun_Quadruplet 'skillessness': 363KB/clock 'skillessness': 363KB/clock'skillessness': 357KB/clock
strstr_Microsoft 'I should have known': 213KB/clock 'I should have known': 208KB/clock'I should have known': 177KB/clock
strstr_GNU_C_Library 'I should have known': 407KB/clock 'I should have known': 393KB/clock'I should have known': 373KB/clock
Railgun 'I should have known': 369KB/clock 'I should have known': 359KB/clock'I should have known': 371KB/clock
Railgun_Quadruplet 'I should have known': 437KB/clock 'I should have known': 438KB/clock'I should have known': 424KB/clock
strstr_Microsoft 'human consciousness': 197KB/clock 'human consciousness': 193KB/clock'human consciousness': 166KB/clock
strstr_GNU_C_Library 'human consciousness': 356KB/clock 'human consciousness': 344KB/clock'human consciousness': 346KB/clock
Railgun 'human consciousness': 366KB/clock 'human consciousness': 355KB/clock'human consciousness': 367KB/clock
Railgun_Quadruplet 'human consciousness': 389KB/clock 'human consciousness': 389KB/clock'human consciousness': 382KB/clock

Dataset: 2,459,508 lines; File: OSHO.TXT 206,908,949 bytes; Shortest/Longest line: 0/161 chars

Note #1: The benchmark program is compiled as 32bit code:
         compile line: cl /Ox strstr_SHORT-SHOWDOWN.c
         compile line: icl /O3 /Qparallel strstr_SHORT-SHOWDOWN.c
Note #2: The cells of fastest searcher for a given pattern are enlightened in grey-blue color.

For reference: www.sanmayce.com/Railgun/index.html#Heavy-Search-Hustle

The test(downloadable at the bottom of this page) run on Merom 2166Mhz:
D:\_KAZE_IntelC_11-1-65_GRAFFITH_workshop\_KAZE_strstr_SHORT-SHOWDOWN_r6>dir

12/22/2010  04:01 AM                13 frustration
12/21/2010  07:27 AM       206,908,949 OSHO.TXT
12/22/2010  04:46 AM            44,444 Results_Merom_2166Mhz.txt
12/22/2010  04:58 AM               339 RUNME.BAT
12/22/2010  03:55 AM            76,950 strstr_SHORT-SHOWDOWN.c
12/22/2010  03:57 AM           473,600 strstr_SHORT-SHOWDOWN_Intel_O3_Qparallel.exe
12/22/2010  03:55 AM           198,161 strstr_SHORT-SHOWDOWN_Microsoft_Ox.cod
12/22/2010  03:55 AM            85,504 strstr_SHORT-SHOWDOWN_Microsoft_Ox.exe

D:\_KAZE_IntelC_11-1-65_GRAFFITH_workshop\_KAZE_strstr_SHORT-SHOWDOWN_r6>RUNME.BAT

D:\_KAZE_IntelC_11-1-65_GRAFFITH_workshop\_KAZE_strstr_SHORT-SHOWDOWN_r6>echo Pattern: frustration 1>Results.txt

D:\_KAZE_IntelC_11-1-65_GRAFFITH_workshop\_KAZE_strstr_SHORT-SHOWDOWN_r6>echo.1>>Results.txt

D:\_KAZE_IntelC_11-1-65_GRAFFITH_workshop\_KAZE_strstr_SHORT-SHOWDOWN_r6>echo strstr_SHORT-SHOWDOWN_Microsoft_Ox.exe: 1>>Results.txt

D:\_KAZE_IntelC_11-1-65_GRAFFITH_workshop\_KAZE_strstr_SHORT-SHOWDOWN_r6>strstr_SHORT-SHOWDOWN_Microsoft_Ox.exe0<frustration 1>>Results.txt

D:\_KAZE_IntelC_11-1-65_GRAFFITH_workshop\_KAZE_strstr_SHORT-SHOWDOWN_r6>echo.1>>Results.txt

D:\_KAZE_IntelC_11-1-65_GRAFFITH_workshop\_KAZE_strstr_SHORT-SHOWDOWN_r6>echo strstr_SHORT-SHOWDOWN_Intel_O3_Qparallel.exe: 1>>Results.txt

D:\_KAZE_IntelC_11-1-65_GRAFFITH_workshop\_KAZE_strstr_SHORT-SHOWDOWN_r6>strstr_SHORT-SHOWDOWN_Intel_O3_Qparallel.exe0<frustration 1>>Results.txt

D:\_KAZE_IntelC_11-1-65_GRAFFITH_workshop\_KAZE_strstr_SHORT-SHOWDOWN_r6>type Results.txt
Pattern: frustration

strstr_SHORT-SHOWDOWN_Microsoft_Ox.exe:
strstr_SHORT-SHOWDOWN, revision 6, written by Kaze.
Input Pattern(up to 19+2000 chars): Doing Search for Pattern(11bytes) into String(206908949bytes) line-by-line ...
LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 1269/859
strstr_Microsoft performance: 232KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1269/497
strstr_GNU_C_Library performance: 401KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 1269/563
Railgun performance: 354KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 1269/505
Railgun_Quadruplet performance: 395KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
KarpRabinKaze_BOOSTED_hits/KarpRabinKaze_BOOSTED_clocks: 1269/568
KarpRabinKaze_BOOSTED performance: 351KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
KarpRabinKaze_hits/KarpRabinKaze_clocks: 1269/579
KarpRabinKaze performance: 344KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
Karp_Rabin_hits/Karp_Rabin_clocks: 1269/707
Karp_Rabin performance: 282KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
Brute_Force_Dummy_hits/Brute_Force_Dummy_clocks: 1269/705
Brute_Force_Dummy performance: 283KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
Boyer-Moore-Horspool_hits/Boyer-Moore-Horspool_clocks: 1269/611
Boyer-Moore-Horspool performance: 326KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
Boyer_Moore_Horspool_Kaze_hits/Boyer_Moore_Horspool_Kaze_clocks: 1269/640
Boyer_Moore_Horspool_Kaze performance: 311KB/clock
StrnglenTRAVERSED: 204383508 bytes

Doing Search for Pattern(11bytes) into String(206908949bytes) as-one-line ...
Railgun_hits/Railgun_clocks: 1355/153
Railgun performance: 1320KB/clock

DUMBO 8x2 ...

Searching for Pattern('an',2bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 75781/786
strstr_Microsoft performance: 172KB/clock
StrnglenTRAVERSED: 138478024 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 75781/483
strstr_GNU_C_Library performance: 279KB/clock
StrnglenTRAVERSED: 138478024 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 75781/515
Railgun performance: 262KB/clock
StrnglenTRAVERSED: 138478024 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 75781/509
Railgun_Quadruplet performance: 265KB/clock
StrnglenTRAVERSED: 138478024 bytes

Searching for Pattern('to',2bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 48760/896
strstr_Microsoft performance: 179KB/clock
StrnglenTRAVERSED: 164505415 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 48760/540
strstr_GNU_C_Library performance: 297KB/clock
StrnglenTRAVERSED: 164505415 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 48760/546
Railgun performance: 294KB/clock
StrnglenTRAVERSED: 164505415 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 48760/540
Railgun_Quadruplet performance: 297KB/clock
StrnglenTRAVERSED: 164505415 bytes

Searching for Pattern('TDK',3bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/929
strstr_Microsoft performance: 214KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/485
strstr_GNU_C_Library performance: 411KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/588
Railgun performance: 339KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/584
Railgun_Quadruplet performance: 341KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('the',3bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 74500/807
strstr_Microsoft performance: 164KB/clock
StrnglenTRAVERSED: 135882884 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 74500/518
strstr_GNU_C_Library performance: 256KB/clock
StrnglenTRAVERSED: 135882884 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 74500/505
Railgun performance: 262KB/clock
StrnglenTRAVERSED: 135882884 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 74500/503
Railgun_Quadruplet performance: 263KB/clock
StrnglenTRAVERSED: 135882884 bytes

Searching for Pattern('fast',4bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 336/946
strstr_Microsoft performance: 210KB/clock
StrnglenTRAVERSED: 204186782 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 336/503
strstr_GNU_C_Library performance: 396KB/clock
StrnglenTRAVERSED: 204186782 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 336/588
Railgun performance: 339KB/clock
StrnglenTRAVERSED: 204186782 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 336/504
Railgun_Quadruplet performance: 395KB/clock
StrnglenTRAVERSED: 204186782 bytes

Searching for Pattern('easy',4bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 301/1123
strstr_Microsoft performance: 177KB/clock
StrnglenTRAVERSED: 204202166 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 301/672
strstr_GNU_C_Library performance: 296KB/clock
StrnglenTRAVERSED: 204202166 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 301/590
Railgun performance: 337KB/clock
StrnglenTRAVERSED: 204202166 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 301/660
Railgun_Quadruplet performance: 302KB/clock
StrnglenTRAVERSED: 204202166 bytes

Searching for Pattern('grmbl',5bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/953
strstr_Microsoft performance: 209KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/507
strstr_GNU_C_Library performance: 393KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/584
Railgun performance: 341KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/505
Railgun_Quadruplet performance: 395KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('email',5bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/1120
strstr_Microsoft performance: 178KB/clock
StrnglenTRAVERSED: 204449414 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/663
strstr_GNU_C_Library performance: 301KB/clock
StrnglenTRAVERSED: 204449414 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/590
Railgun performance: 338KB/clock
StrnglenTRAVERSED: 204449414 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/658
Railgun_Quadruplet performance: 303KB/clock
StrnglenTRAVERSED: 204449414 bytes

Searching for Pattern('pasting',7bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/947
strstr_Microsoft performance: 210KB/clock
StrnglenTRAVERSED: 204449363 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/503
strstr_GNU_C_Library performance: 396KB/clock
StrnglenTRAVERSED: 204449363 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/576
Railgun performance: 346KB/clock
StrnglenTRAVERSED: 204449363 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/497
Railgun_Quadruplet performance: 401KB/clock
StrnglenTRAVERSED: 204449363 bytes

Searching for Pattern('amazing',7bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 19/1044
strstr_Microsoft performance: 191KB/clock
StrnglenTRAVERSED: 204432134 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 19/589
strstr_GNU_C_Library performance: 338KB/clock
StrnglenTRAVERSED: 204432134 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 19/577
Railgun performance: 345KB/clock
StrnglenTRAVERSED: 204432134 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 19/575
Railgun_Quadruplet performance: 347KB/clock
StrnglenTRAVERSED: 204432134 bytes

Searching for Pattern('underdog',8bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/979
strstr_Microsoft performance: 203KB/clock
StrnglenTRAVERSED: 204449185 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/530
strstr_GNU_C_Library performance: 376KB/clock
StrnglenTRAVERSED: 204449185 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/573
Railgun performance: 348KB/clock
StrnglenTRAVERSED: 204449185 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/518
Railgun_Quadruplet performance: 385KB/clock
StrnglenTRAVERSED: 204449185 bytes

Searching for Pattern('superdog',8bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/1023
strstr_Microsoft performance: 195KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/575
strstr_GNU_C_Library performance: 347KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/575
Railgun performance: 347KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/561
Railgun_Quadruplet performance: 355KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('participants',12bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 8/948
strstr_Microsoft performance: 210KB/clock
StrnglenTRAVERSED: 204441500 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 8/503
strstr_GNU_C_Library performance: 396KB/clock
StrnglenTRAVERSED: 204441500 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 8/561
Railgun performance: 355KB/clock
StrnglenTRAVERSED: 204441500 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 8/485
Railgun_Quadruplet performance: 411KB/clock
StrnglenTRAVERSED: 204441500 bytes

Searching for Pattern('skillessness',12bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/1021
strstr_Microsoft performance: 195KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/573
strstr_GNU_C_Library performance: 348KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/567
Railgun performance: 352KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/549
Railgun_Quadruplet performance: 363KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('I should have known',19bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/934
strstr_Microsoft performance: 213KB/clock
StrnglenTRAVERSED: 204449346 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/490
strstr_GNU_C_Library performance: 407KB/clock
StrnglenTRAVERSED: 204449346 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/540
Railgun performance: 369KB/clock
StrnglenTRAVERSED: 204449346 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/456
Railgun_Quadruplet performance: 437KB/clock
StrnglenTRAVERSED: 204449346 bytes

Searching for Pattern('human consciousness',19bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 32/1010
strstr_Microsoft performance: 197KB/clock
StrnglenTRAVERSED: 204422699 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 32/560
strstr_GNU_C_Library performance: 356KB/clock
StrnglenTRAVERSED: 204422699 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 32/545
Railgun performance: 366KB/clock
StrnglenTRAVERSED: 204422699 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 32/512
Railgun_Quadruplet performance: 389KB/clock
StrnglenTRAVERSED: 204422699 bytes

Doing Search for 8x2 Patterns into String(206908949bytes) as-one-line ...
Found ('an') 1987797 time(s), Railgun performance: 300KB/clock
Found ('to') 1076629 time(s), Railgun performance: 300KB/clock
Found ('TDK') 0 time(s), Railgun performance: 515KB/clock
Found ('the') 2114180 time(s), Railgun performance: 403KB/clock
Found ('fast') 5945 time(s), Railgun performance: 561KB/clock
Found ('easy') 5191 time(s), Railgun performance: 612KB/clock
Found ('grmbl') 0 time(s), Railgun performance: 805KB/clock
Found ('email') 1 time(s), Railgun performance: 716KB/clock
Found ('pasting') 2 time(s), Railgun performance: 990KB/clock
Found ('amazing') 323 time(s), Railgun performance: 990KB/clock
Found ('underdog') 4 time(s), Railgun performance: 1167KB/clock
Found ('superdog') 0 time(s), Railgun performance: 1074KB/clock
Found ('participants') 147 time(s), Railgun performance: 1603KB/clock
Found ('skillessness') 0 time(s), Railgun performance: 1422KB/clock
Found ('I should have known') 1 time(s), Railgun performance: 1603KB/clock
Found ('human consciousness') 519 time(s), Railgun performance: 1603KB/clock
Railgun 8x2 i.e. average performance: 682KB/clock

strstr_SHORT-SHOWDOWN_Intel_O3_Qparallel.exe:
strstr_SHORT-SHOWDOWN, revision 6, written by Kaze.
Input Pattern(up to 19+2000 chars): Doing Search for Pattern(11bytes) into String(206908949bytes) line-by-line ...
LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 1269/1150
strstr_Microsoft performance: 173KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 1269/508
strstr_GNU_C_Library performance: 392KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 1269/565
Railgun performance: 353KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 1269/504
Railgun_Quadruplet performance: 396KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
KarpRabinKaze_BOOSTED_hits/KarpRabinKaze_BOOSTED_clocks: 1269/575
KarpRabinKaze_BOOSTED performance: 347KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
KarpRabinKaze_hits/KarpRabinKaze_clocks: 1269/654
KarpRabinKaze performance: 305KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
Karp_Rabin_hits/Karp_Rabin_clocks: 1269/853
Karp_Rabin performance: 233KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
Brute_Force_Dummy_hits/Brute_Force_Dummy_clocks: 1269/653
Brute_Force_Dummy performance: 305KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
Boyer-Moore-Horspool_hits/Boyer-Moore-Horspool_clocks: 1269/739
Boyer-Moore-Horspool performance: 270KB/clock
StrnglenTRAVERSED: 204383508 bytes
LinesEncountered: 2459508
Boyer_Moore_Horspool_Kaze_hits/Boyer_Moore_Horspool_Kaze_clocks: 1269/738
Boyer_Moore_Horspool_Kaze performance: 270KB/clock
StrnglenTRAVERSED: 204383508 bytes

Doing Search for Pattern(11bytes) into String(206908949bytes) as-one-line ...
Railgun_hits/Railgun_clocks: 1355/101
Railgun performance: 2000KB/clock

DUMBO 8x2 ...

Searching for Pattern('an',2bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 75781/917
strstr_Microsoft performance: 147KB/clock
StrnglenTRAVERSED: 138478024 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 75781/503
strstr_GNU_C_Library performance: 268KB/clock
StrnglenTRAVERSED: 138478024 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 75781/526
Railgun performance: 257KB/clock
StrnglenTRAVERSED: 138478024 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 75781/484
Railgun_Quadruplet performance: 279KB/clock
StrnglenTRAVERSED: 138478024 bytes

Searching for Pattern('to',2bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 48760/1050
strstr_Microsoft performance: 152KB/clock
StrnglenTRAVERSED: 164505415 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 48760/562
strstr_GNU_C_Library performance: 285KB/clock
StrnglenTRAVERSED: 164505415 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 48760/550
Railgun performance: 292KB/clock
StrnglenTRAVERSED: 164505415 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 48760/518
Railgun_Quadruplet performance: 310KB/clock
StrnglenTRAVERSED: 164505415 bytes

Searching for Pattern('TDK',3bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/1120
strstr_Microsoft performance: 178KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/532
strstr_GNU_C_Library performance: 375KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/586
Railgun performance: 340KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/569
Railgun_Quadruplet performance: 350KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('the',3bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 74500/938
strstr_Microsoft performance: 141KB/clock
StrnglenTRAVERSED: 135882884 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 74500/543
strstr_GNU_C_Library performance: 244KB/clock
StrnglenTRAVERSED: 135882884 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 74500/507
Railgun performance: 261KB/clock
StrnglenTRAVERSED: 135882884 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 74500/488
Railgun_Quadruplet performance: 271KB/clock
StrnglenTRAVERSED: 135882884 bytes

Searching for Pattern('fast',4bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 336/1135
strstr_Microsoft performance: 175KB/clock
StrnglenTRAVERSED: 204186782 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 336/531
strstr_GNU_C_Library performance: 375KB/clock
StrnglenTRAVERSED: 204186782 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 336/587
Railgun performance: 339KB/clock
StrnglenTRAVERSED: 204186782 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 336/521
Railgun_Quadruplet performance: 382KB/clock
StrnglenTRAVERSED: 204186782 bytes

Searching for Pattern('easy',4bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 301/1310
strstr_Microsoft performance: 152KB/clock
StrnglenTRAVERSED: 204202166 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 301/709
strstr_GNU_C_Library performance: 281KB/clock
StrnglenTRAVERSED: 204202166 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 301/588
Railgun performance: 339KB/clock
StrnglenTRAVERSED: 204202166 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 301/669
Railgun_Quadruplet performance: 298KB/clock
StrnglenTRAVERSED: 204202166 bytes

Searching for Pattern('grmbl',5bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/1140
strstr_Microsoft performance: 175KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/532
strstr_GNU_C_Library performance: 375KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/580
Railgun performance: 344KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/521
Railgun_Quadruplet performance: 383KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('email',5bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/1307
strstr_Microsoft performance: 152KB/clock
StrnglenTRAVERSED: 204449414 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/699
strstr_GNU_C_Library performance: 285KB/clock
StrnglenTRAVERSED: 204449414 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/587
Railgun performance: 340KB/clock
StrnglenTRAVERSED: 204449414 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/666
Railgun_Quadruplet performance: 299KB/clock
StrnglenTRAVERSED: 204449414 bytes

Searching for Pattern('pasting',7bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/1135
strstr_Microsoft performance: 175KB/clock
StrnglenTRAVERSED: 204449363 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/533
strstr_GNU_C_Library performance: 374KB/clock
StrnglenTRAVERSED: 204449363 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/574
Railgun performance: 347KB/clock
StrnglenTRAVERSED: 204449363 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/513
Railgun_Quadruplet performance: 389KB/clock
StrnglenTRAVERSED: 204449363 bytes

Searching for Pattern('amazing',7bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 19/1230
strstr_Microsoft performance: 162KB/clock
StrnglenTRAVERSED: 204432134 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 19/610
strstr_GNU_C_Library performance: 327KB/clock
StrnglenTRAVERSED: 204432134 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 19/574
Railgun performance: 347KB/clock
StrnglenTRAVERSED: 204432134 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 19/586
Railgun_Quadruplet performance: 340KB/clock
StrnglenTRAVERSED: 204432134 bytes

Searching for Pattern('underdog',8bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/1169
strstr_Microsoft performance: 170KB/clock
StrnglenTRAVERSED: 204449185 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/549
strstr_GNU_C_Library performance: 363KB/clock
StrnglenTRAVERSED: 204449185 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/570
Railgun performance: 350KB/clock
StrnglenTRAVERSED: 204449185 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/531
Railgun_Quadruplet performance: 376KB/clock
StrnglenTRAVERSED: 204449185 bytes

Searching for Pattern('superdog',8bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/1212
strstr_Microsoft performance: 164KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/595
strstr_GNU_C_Library performance: 335KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/573
Railgun performance: 348KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/573
Railgun_Quadruplet performance: 348KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('participants',12bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 8/1137
strstr_Microsoft performance: 175KB/clock
StrnglenTRAVERSED: 204441500 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 8/535
strstr_GNU_C_Library performance: 373KB/clock
StrnglenTRAVERSED: 204441500 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 8/559
Railgun performance: 357KB/clock
StrnglenTRAVERSED: 204441500 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 8/499
Railgun_Quadruplet performance: 400KB/clock
StrnglenTRAVERSED: 204441500 bytes

Searching for Pattern('skillessness',12bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/1212
strstr_Microsoft performance: 164KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/593
strstr_GNU_C_Library performance: 336KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/565
Railgun performance: 353KB/clock
StrnglenTRAVERSED: 204449441 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/558
Railgun_Quadruplet performance: 357KB/clock
StrnglenTRAVERSED: 204449441 bytes

Searching for Pattern('I should have known',19bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 0/1126
strstr_Microsoft performance: 177KB/clock
StrnglenTRAVERSED: 204449346 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 0/534
strstr_GNU_C_Library performance: 373KB/clock
StrnglenTRAVERSED: 204449346 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 0/537
Railgun performance: 371KB/clock
StrnglenTRAVERSED: 204449346 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 0/470
Railgun_Quadruplet performance: 424KB/clock
StrnglenTRAVERSED: 204449346 bytes

Searching for Pattern('human consciousness',19bytes) into String(206908949bytes) line-by-line ...

LinesEncountered: 2459508
strstr_Microsoft_hits/strstr_Microsoft_clocks: 32/1200
strstr_Microsoft performance: 166KB/clock
StrnglenTRAVERSED: 204422699 bytes
LinesEncountered: 2459508
strstr_GNU_C_Library_hits/strstr_GNU_C_Library_clocks: 32/576
strstr_GNU_C_Library performance: 346KB/clock
StrnglenTRAVERSED: 204422699 bytes
LinesEncountered: 2459508
Railgun_hits/Railgun_clocks: 32/543
Railgun performance: 367KB/clock
StrnglenTRAVERSED: 204422699 bytes
LinesEncountered: 2459508
Railgun_Quadruplet_hits/Railgun_Quadruplet_clocks: 32/522
Railgun_Quadruplet performance: 382KB/clock
StrnglenTRAVERSED: 204422699 bytes

Doing Search for 8x2 Patterns into String(206908949bytes) as-one-line ...
Found ('an') 1987797 time(s), Railgun performance: 461KB/clock
Found ('to') 1076629 time(s), Railgun performance: 495KB/clock
Found ('TDK') 0 time(s), Railgun performance: 859KB/clock
Found ('the') 2114180 time(s), Railgun performance: 585KB/clock
Found ('fast') 5945 time(s), Railgun performance: 922KB/clock
Found ('easy') 5191 time(s), Railgun performance: 985KB/clock
Found ('grmbl') 0 time(s), Railgun performance: 1287KB/clock
Found ('email') 1 time(s), Railgun performance: 1167KB/clock
Found ('pasting') 2 time(s), Railgun performance: 1603KB/clock
Found ('amazing') 323 time(s), Railgun performance: 1603KB/clock
Found ('underdog') 4 time(s), Railgun performance: 1836KB/clock
Found ('superdog') 0 time(s), Railgun performance: 1836KB/clock
Found ('participants') 147 time(s), Railgun performance: 2525KB/clock
Found ('skillessness') 0 time(s), Railgun performance: 2149KB/clock
Found ('I should have known') 1 time(s), Railgun performance: 2126KB/clock
Found ('human consciousness') 519 time(s), Railgun performance: 2557KB/clock
Railgun 8x2 i.e. average performance: 1085KB/clock

D:\_KAZE_IntelC_11-1-65_GRAFFITH_workshop\_KAZE_strstr_SHORT-SHOWDOWN_r6>

Some 64bit quick tests from 2012-Feb-29:
'Trident' vs BNDM_64 vs 'Elsiane' vs 'Hasherezade' all compiled as 64bit with Intel and Microsoft:
A quick look at 16/32/48/64 bytes patterns (49 in total) against 197MB (English text) and 212MB (DNA sequence) haystacks.

Okay two haystacks under fire on Core 2 Duo E7500 2.93GHz:

1] OSHO.TXT, Intel compiled:

Railgun_Quadruplet_7Trident 49 i.e. average performance: 3281KB/clock
Railgun_Quadruplet_7Trident 49 total Skip-Performance/Iterations: 2532816/6574958192

BNDM_64 49 i.e. average performance: 3013KB/clock
BNDM_64 49 total Skip-Performance/Iterations: 2779920/6213485968

Railgun_Quadruplet_7Elsiane 49 i.e. average performance: 2732KB/clock
Railgun_Quadruplet_7Elsiane 49 total Skip-Performance/Iterations: 1880784/8251788448

Railgun_Quadruplet_7Hasherezade 49 i.e. average performance: 2891KB/clock
Railgun_Quadruplet_7Hasherezade 49 total Skip-Performance/Iterations: 2701232/6466619104

2] OSHO.TXT, Microsoft compiled:

Railgun_Quadruplet_7Trident 49 i.e. average performance: 3266KB/clock
Railgun_Quadruplet_7Trident 49 total Skip-Performance/Iterations: 2532816/6574958192

BNDM_64 49 i.e. average performance: 3017KB/clock
BNDM_64 49 total Skip-Performance/Iterations: 2779920/6213485968

Railgun_Quadruplet_7Elsiane 49 i.e. average performance: 2245KB/clock
Railgun_Quadruplet_7Elsiane 49 total Skip-Performance/Iterations: 1880784/8251788448

Railgun_Quadruplet_7Hasherezade 49 i.e. average performance: 3081KB/clock
Railgun_Quadruplet_7Hasherezade 49 total Skip-Performance/Iterations: 2701232/6466619104

3] hs_alt_HuRef_chr1.fa, Intel compiled:

Railgun_Quadruplet_7Trident 49 i.e. average performance: 3016KB/clock
Railgun_Quadruplet_7Trident 49 total Skip-Performance/Iterations: 2479456/7653285440

BNDM_64 49 i.e. average performance: 3761KB/clock
BNDM_64 49 total Skip-Performance/Iterations: 2806144/6595760528

Railgun_Quadruplet_7Elsiane 49 i.e. average performance: 3164KB/clock
Railgun_Quadruplet_7Elsiane 49 total Skip-Performance/Iterations: 2540592/9256480624

Railgun_Quadruplet_7Hasherezade 49 i.e. average performance: 2827KB/clock
Railgun_Quadruplet_7Hasherezade 49 total Skip-Performance/Iterations: 2691888/7089590528

4] hs_alt_HuRef_chr1.fa, Microsoft compiled:

Railgun_Quadruplet_7Trident 49 i.e. average performance: 3064KB/clock
Railgun_Quadruplet_7Trident 49 total Skip-Performance/Iterations: 2479456/7653285440

BNDM_64 49 i.e. average performance: 3735KB/clock
BNDM_64 49 total Skip-Performance/Iterations: 2806144/6595760528

Railgun_Quadruplet_7Elsiane 49 i.e. average performance: 2679KB/clock
Railgun_Quadruplet_7Elsiane 49 total Skip-Performance/Iterations: 2540592/9256480624

Railgun_Quadruplet_7Hasherezade 49 i.e. average performance: 2997KB/clock
Railgun_Quadruplet_7Hasherezade 49 total Skip-Performance/Iterations: 2691888/7089590528

Quick note1: 'Trident'is still using BNDM_32 depth 3 probing - to be replaced with BNDM_64 depth 4 probing.
Quick note2: It is notable how Intel generates more effective code for 'Elsiane' - 500MB/s more!
Quick note3: 'Trident' being 200MB/s faster than BNDM_64 for text and 700MB/s slower than BNDM_64 for DNA, ouch!
Quick note4: BNDM_64 is superb, I already recondsidered its role - it will cover the whole 2..64 range.

~[ Full dump as follows: ]~

1] OSHO.TXT, Intel compiled:

Found ('If you have read') 9 time(s), Railgun_Quadruplet_7Trident performance: 2590KB/clock
Found ('you should have ') 181 time(s), Railgun_Quadruplet_7Trident performance: 2590KB/clock
Found ('pretty good idea') 1 time(s), Railgun_Quadruplet_7Trident performance: 2886KB/clock
Found ('Osho Books on CD') 4 time(s), Railgun_Quadruplet_7Trident performance: 2845KB/clock
Found ('use you will put') 1 time(s), Railgun_Quadruplet_7Trident performance: 2658KB/clock
Found ('to is up to you.') 1 time(s), Railgun_Quadruplet_7Trident performance: 2658KB/clock
Found ('the largest ever') 1 time(s), Railgun_Quadruplet_7Trident performance: 2525KB/clock
Found ('of understanding') 852 time(s), Railgun_Quadruplet_7Trident performance: 2806KB/clock
Found ('and knowledge on') 1 time(s), Railgun_Quadruplet_7Trident performance: 2730KB/clock
Found ('more, a complete') 1 time(s), Railgun_Quadruplet_7Trident performance: 2806KB/clock
Found ('and a new way of') 5 time(s), Railgun_Quadruplet_7Trident performance: 2730KB/clock
Found ('access to Osho's') 1 time(s), Railgun_Quadruplet_7Trident performance: 2806KB/clock
Found ('words, ideas and') 1 time(s), Railgun_Quadruplet_7Trident performance: 2658KB/clock
Found ('ideas and vision') 1 time(s), Railgun_Quadruplet_7Trident performance: 2658KB/clock
Found ('and to make them') 6 time(s), Railgun_Quadruplet_7Trident performance: 2377KB/clock
Found ('AGATTTTAAAGATTTT') 0 time(s), Railgun_Quadruplet_7Trident performance: 3061KB/clock
Found ('TTGACATAGAATCTTA') 0 time(s), Railgun_Quadruplet_7Trident performance: 3157KB/clock
Found ('TGGAGGCTGAGAAATA') 0 time(s), Railgun_Quadruplet_7Trident performance: 3157KB/clock
Found ('fastest fox with biggest strides') 0 time(s), Railgun_Quadruplet_7Trident performance: 3483KB/clock
Found ('you will put it to is up to you.') 1 time(s), Railgun_Quadruplet_7Trident performance: 3424KB/clock
Found ('on meditation and its techniques') 1 time(s), Railgun_Quadruplet_7Trident performance: 3424KB/clock
Found ('way of life. The purpose of this') 1 time(s), Railgun_Quadruplet_7Trident performance: 3312KB/clock
Found ('ROM is to provide access to Osho') 1 time(s), Railgun_Quadruplet_7Trident performance: 3483KB/clock
Found ('Osho's words, ideas and vision, ') 1 time(s), Railgun_Quadruplet_7Trident performance: 3424KB/clock
Found ('and to make them available to as') 1 time(s), Railgun_Quadruplet_7Trident performance: 3424KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 0 time(s), Railgun_Quadruplet_7Trident performance: 3812KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), Railgun_Quadruplet_7Trident performance: 3812KB/clock
Found ('you have read through the preceding chapters you') 1 time(s), Railgun_Quadruplet_7Trident performance: 3544KB/clock
Found ('through the preceding chapters you should have a') 1 time(s), Railgun_Quadruplet_7Trident performance: 3608KB/clock
Found ('preceding chapters you should have a pretty good') 1 time(s), Railgun_Quadruplet_7Trident performance: 3608KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 1 time(s), Railgun_Quadruplet_7Trident performance: 3608KB/clock
Found ('of understanding and knowledge on meditation and') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('much more, a complete, world view of the New Man') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('world view of the New Man and a new way of life.') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('is to provide access to Osho's words, ideas and ') 1 time(s), Railgun_Quadruplet_7Trident performance: 3608KB/clock
Found ('provide access to Osho's words, ideas and vision') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('access to Osho's words, ideas and vision, and to') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('Osho's words, ideas and vision, and to make them') 1 time(s), Railgun_Quadruplet_7Trident performance: 3544KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 0 time(s), Railgun_Quadruplet_7Trident performance: 3885KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 0 time(s), Railgun_Quadruplet_7Trident performance: 3885KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 1 time(s), Railgun_Quadruplet_7Trident performance: 3741KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 1 time(s), Railgun_Quadruplet_7Trident performance: 3741KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 1 time(s), Railgun_Quadruplet_7Trident performance: 3741KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), Railgun_Quadruplet_7Trident performance: 3961KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 0 time(s), Railgun_Quadruplet_7Trident performance: 3961KB/clock

Railgun_Quadruplet_7Trident 49 i.e. average performance: 3281KB/clock
Railgun_Quadruplet_7Trident 49 total Skip-Performance/Iterations: 2532816/6574958192

Found ('If you have read') 9 time(s), BNDM_64 performance: 1820KB/clock
Found ('you should have ') 181 time(s), BNDM_64 performance: 1870KB/clock
Found ('pretty good idea') 1 time(s), BNDM_64 performance: 2149KB/clock
Found ('Osho Books on CD') 4 time(s), BNDM_64 performance: 2061KB/clock
Found ('use you will put') 1 time(s), BNDM_64 performance: 1870KB/clock
Found ('to is up to you.') 1 time(s), BNDM_64 performance: 1820KB/clock
Found ('the largest ever') 1 time(s), BNDM_64 performance: 1804KB/clock
Found ('of understanding') 852 time(s), BNDM_64 performance: 2245KB/clock
Found ('and knowledge on') 1 time(s), BNDM_64 performance: 1906KB/clock
Found ('more, a complete') 1 time(s), BNDM_64 performance: 1980KB/clock
Found ('and a new way of') 5 time(s), BNDM_64 performance: 1888KB/clock
Found ('access to Osho's') 1 time(s), BNDM_64 performance: 2000KB/clock
Found ('words, ideas and') 1 time(s), BNDM_64 performance: 1980KB/clock
Found ('ideas and vision') 1 time(s), BNDM_64 performance: 1888KB/clock
Found ('and to make them') 6 time(s), BNDM_64 performance: 1683KB/clock
Found ('AGATTTTAAAGATTTT') 0 time(s), BNDM_64 performance: 4699KB/clock
Found ('TTGACATAGAATCTTA') 0 time(s), BNDM_64 performance: 4699KB/clock
Found ('TGGAGGCTGAGAAATA') 0 time(s), BNDM_64 performance: 4592KB/clock
Found ('fastest fox with biggest strides') 0 time(s), BNDM_64 performance: 3608KB/clock
Found ('you will put it to is up to you.') 1 time(s), BNDM_64 performance: 2928KB/clock
Found ('on meditation and its techniques') 1 time(s), BNDM_64 performance: 3259KB/clock
Found ('way of life. The purpose of this') 1 time(s), BNDM_64 performance: 3259KB/clock
Found ('ROM is to provide access to Osho') 1 time(s), BNDM_64 performance: 3259KB/clock
Found ('Osho's words, ideas and vision, ') 1 time(s), BNDM_64 performance: 3312KB/clock
Found ('and to make them available to as') 1 time(s), BNDM_64 performance: 3157KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 0 time(s), BNDM_64 performance: 5051KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), BNDM_64 performance: 5051KB/clock
Found ('you have read through the preceding chapters you') 1 time(s), BNDM_64 performance: 3741KB/clock
Found ('through the preceding chapters you should have a') 1 time(s), BNDM_64 performance: 3741KB/clock
Found ('preceding chapters you should have a pretty good') 1 time(s), BNDM_64 performance: 3961KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 1 time(s), BNDM_64 performance: 3741KB/clock
Found ('of understanding and knowledge on meditation and') 1 time(s), BNDM_64 performance: 3961KB/clock
Found ('much more, a complete, world view of the New Man') 1 time(s), BNDM_64 performance: 3961KB/clock
Found ('world view of the New Man and a new way of life.') 1 time(s), BNDM_64 performance: 3812KB/clock
Found ('is to provide access to Osho's words, ideas and ') 1 time(s), BNDM_64 performance: 3961KB/clock
Found ('provide access to Osho's words, ideas and vision') 1 time(s), BNDM_64 performance: 3961KB/clock
Found ('access to Osho's words, ideas and vision, and to') 1 time(s), BNDM_64 performance: 3961KB/clock
Found ('Osho's words, ideas and vision, and to make them') 1 time(s), BNDM_64 performance: 3741KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 0 time(s), BNDM_64 performance: 4699KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 0 time(s), BNDM_64 performance: 4699KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 1 time(s), BNDM_64 performance: 4123KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 1 time(s), BNDM_64 performance: 4041KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 1 time(s), BNDM_64 performance: 3961KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 1 time(s), BNDM_64 performance: 4123KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 1 time(s), BNDM_64 performance: 4299KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 1 time(s), BNDM_64 performance: 4209KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 1 time(s), BNDM_64 performance: 4123KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), BNDM_64 performance: 4810KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 0 time(s), BNDM_64 performance: 4810KB/clock

BNDM_64 49 i.e. average performance: 3013KB/clock
BNDM_64 49 total Skip-Performance/Iterations: 2779920/6213485968

Found ('If you have read') 9 time(s), Railgun_Quadruplet_7Elsiane performance: 1836KB/clock
Found ('you should have ') 181 time(s), Railgun_Quadruplet_7Elsiane performance: 1820KB/clock
Found ('pretty good idea') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1942KB/clock
Found ('Osho Books on CD') 4 time(s), Railgun_Quadruplet_7Elsiane performance: 1669KB/clock
Found ('use you will put') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1836KB/clock
Found ('to is up to you.') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1741KB/clock
Found ('the largest ever') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1727KB/clock
Found ('of understanding') 852 time(s), Railgun_Quadruplet_7Elsiane performance: 2149KB/clock
Found ('and knowledge on') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1683KB/clock
Found ('more, a complete') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1924KB/clock
Found ('and a new way of') 5 time(s), Railgun_Quadruplet_7Elsiane performance: 1683KB/clock
Found ('access to Osho's') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1942KB/clock
Found ('words, ideas and') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1788KB/clock
Found ('ideas and vision') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1924KB/clock
Found ('and to make them') 6 time(s), Railgun_Quadruplet_7Elsiane performance: 1788KB/clock
Found ('AGATTTTAAAGATTTT') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4392KB/clock
Found ('TTGACATAGAATCTTA') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4299KB/clock
Found ('TGGAGGCTGAGAAATA') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4299KB/clock
Found ('fastest fox with biggest strides') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 2886KB/clock
Found ('you will put it to is up to you.') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2730KB/clock
Found ('on meditation and its techniques') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2845KB/clock
Found ('way of life. The purpose of this') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2730KB/clock
Found ('ROM is to provide access to Osho') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2767KB/clock
Found ('Osho's words, ideas and vision, ') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2971KB/clock
Found ('and to make them available to as') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2590KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4810KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4810KB/clock
Found ('you have read through the preceding chapters you') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2767KB/clock
Found ('through the preceding chapters you should have a') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2767KB/clock
Found ('preceding chapters you should have a pretty good') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3259KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3483KB/clock
Found ('of understanding and knowledge on meditation and') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3312KB/clock
Found ('much more, a complete, world view of the New Man') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3207KB/clock
Found ('world view of the New Man and a new way of life.') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3483KB/clock
Found ('is to provide access to Osho's words, ideas and ') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3157KB/clock
Found ('provide access to Osho's words, ideas and vision') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3424KB/clock
Found ('access to Osho's words, ideas and vision, and to') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3157KB/clock
Found ('Osho's words, ideas and vision, and to make them') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3259KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4928KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5051KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3367KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3608KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3608KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3544KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3608KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3608KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3424KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4810KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4810KB/clock

Railgun_Quadruplet_7Elsiane 49 i.e. average performance: 2732KB/clock
Railgun_Quadruplet_7Elsiane 49 total Skip-Performance/Iterations: 1880784/8251788448

Found ('If you have read') 9 time(s), Railgun_Quadruplet_7Hasherezade performance: 2126KB/clock
Found ('you should have ') 181 time(s), Railgun_Quadruplet_7Hasherezade performance: 2149KB/clock
Found ('pretty good idea') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2349KB/clock
Found ('Osho Books on CD') 4 time(s), Railgun_Quadruplet_7Hasherezade performance: 2270KB/clock
Found ('use you will put') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2322KB/clock
Found ('to is up to you.') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2196KB/clock
Found ('the largest ever') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2270KB/clock
Found ('of understanding') 852 time(s), Railgun_Quadruplet_7Hasherezade performance: 2220KB/clock
Found ('and knowledge on') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2245KB/clock
Found ('more, a complete') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2349KB/clock
Found ('and a new way of') 5 time(s), Railgun_Quadruplet_7Hasherezade performance: 2349KB/clock
Found ('access to Osho's') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2270KB/clock
Found ('words, ideas and') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2126KB/clock
Found ('ideas and vision') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2220KB/clock
Found ('and to make them') 6 time(s), Railgun_Quadruplet_7Hasherezade performance: 2020KB/clock
Found ('AGATTTTAAAGATTTT') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2557KB/clock
Found ('TTGACATAGAATCTTA') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2590KB/clock
Found ('TGGAGGCTGAGAAATA') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2590KB/clock
Found ('fastest fox with biggest strides') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3259KB/clock
Found ('you will put it to is up to you.') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3108KB/clock
Found ('on meditation and its techniques') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3061KB/clock
Found ('way of life. The purpose of this') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3061KB/clock
Found ('ROM is to provide access to Osho') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3157KB/clock
Found ('Osho's words, ideas and vision, ') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3157KB/clock
Found ('and to make them available to as') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3061KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3741KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3741KB/clock
Found ('you have read through the preceding chapters you') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3312KB/clock
Found ('through the preceding chapters you should have a') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3259KB/clock
Found ('preceding chapters you should have a pretty good') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3312KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3312KB/clock
Found ('of understanding and knowledge on meditation and') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3367KB/clock
Found ('much more, a complete, world view of the New Man') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3367KB/clock
Found ('world view of the New Man and a new way of life.') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3312KB/clock
Found ('is to provide access to Osho's words, ideas and ') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3367KB/clock
Found ('provide access to Osho's words, ideas and vision') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3312KB/clock
Found ('access to Osho's words, ideas and vision, and to') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3367KB/clock
Found ('Osho's words, ideas and vision, and to make them') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3259KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3812KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3885KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3424KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3424KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3367KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3424KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3424KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3424KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3424KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3961KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3885KB/clock

Railgun_Quadruplet_7Hasherezade 49 i.e. average performance: 2891KB/clock
Railgun_Quadruplet_7Hasherezade 49 total Skip-Performance/Iterations: 2701232/6466619104

2] OSHO.TXT, Microsoft compiled:

Found ('If you have read') 9 time(s), Railgun_Quadruplet_7Trident performance: 2557KB/clock
Found ('you should have ') 181 time(s), Railgun_Quadruplet_7Trident performance: 2624KB/clock
Found ('pretty good idea') 1 time(s), Railgun_Quadruplet_7Trident performance: 2806KB/clock
Found ('Osho Books on CD') 4 time(s), Railgun_Quadruplet_7Trident performance: 2806KB/clock
Found ('use you will put') 1 time(s), Railgun_Quadruplet_7Trident performance: 2624KB/clock
Found ('to is up to you.') 1 time(s), Railgun_Quadruplet_7Trident performance: 2624KB/clock
Found ('the largest ever') 1 time(s), Railgun_Quadruplet_7Trident performance: 2494KB/clock
Found ('of understanding') 852 time(s), Railgun_Quadruplet_7Trident performance: 2730KB/clock
Found ('and knowledge on') 1 time(s), Railgun_Quadruplet_7Trident performance: 2694KB/clock
Found ('more, a complete') 1 time(s), Railgun_Quadruplet_7Trident performance: 2730KB/clock
Found ('and a new way of') 5 time(s), Railgun_Quadruplet_7Trident performance: 2694KB/clock
Found ('access to Osho's') 1 time(s), Railgun_Quadruplet_7Trident performance: 2767KB/clock
Found ('words, ideas and') 1 time(s), Railgun_Quadruplet_7Trident performance: 2590KB/clock
Found ('ideas and vision') 1 time(s), Railgun_Quadruplet_7Trident performance: 2624KB/clock
Found ('and to make them') 6 time(s), Railgun_Quadruplet_7Trident performance: 2322KB/clock
Found ('AGATTTTAAAGATTTT') 0 time(s), Railgun_Quadruplet_7Trident performance: 3312KB/clock
Found ('TTGACATAGAATCTTA') 0 time(s), Railgun_Quadruplet_7Trident performance: 3312KB/clock
Found ('TGGAGGCTGAGAAATA') 0 time(s), Railgun_Quadruplet_7Trident performance: 3312KB/clock
Found ('fastest fox with biggest strides') 0 time(s), Railgun_Quadruplet_7Trident performance: 3483KB/clock
Found ('you will put it to is up to you.') 1 time(s), Railgun_Quadruplet_7Trident performance: 3424KB/clock
Found ('on meditation and its techniques') 1 time(s), Railgun_Quadruplet_7Trident performance: 3367KB/clock
Found ('way of life. The purpose of this') 1 time(s), Railgun_Quadruplet_7Trident performance: 3312KB/clock
Found ('ROM is to provide access to Osho') 1 time(s), Railgun_Quadruplet_7Trident performance: 3367KB/clock
Found ('Osho's words, ideas and vision, ') 1 time(s), Railgun_Quadruplet_7Trident performance: 3424KB/clock
Found ('and to make them available to as') 1 time(s), Railgun_Quadruplet_7Trident performance: 3367KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 0 time(s), Railgun_Quadruplet_7Trident performance: 3885KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), Railgun_Quadruplet_7Trident performance: 3812KB/clock
Found ('you have read through the preceding chapters you') 1 time(s), Railgun_Quadruplet_7Trident performance: 3544KB/clock
Found ('through the preceding chapters you should have a') 1 time(s), Railgun_Quadruplet_7Trident performance: 3544KB/clock
Found ('preceding chapters you should have a pretty good') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 1 time(s), Railgun_Quadruplet_7Trident performance: 3608KB/clock
Found ('of understanding and knowledge on meditation and') 1 time(s), Railgun_Quadruplet_7Trident performance: 3608KB/clock
Found ('much more, a complete, world view of the New Man') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('world view of the New Man and a new way of life.') 1 time(s), Railgun_Quadruplet_7Trident performance: 3608KB/clock
Found ('is to provide access to Osho's words, ideas and ') 1 time(s), Railgun_Quadruplet_7Trident performance: 3608KB/clock
Found ('provide access to Osho's words, ideas and vision') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('access to Osho's words, ideas and vision, and to') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('Osho's words, ideas and vision, and to make them') 1 time(s), Railgun_Quadruplet_7Trident performance: 3483KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 0 time(s), Railgun_Quadruplet_7Trident performance: 3961KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 0 time(s), Railgun_Quadruplet_7Trident performance: 3885KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 1 time(s), Railgun_Quadruplet_7Trident performance: 3608KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 1 time(s), Railgun_Quadruplet_7Trident performance: 3741KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 1 time(s), Railgun_Quadruplet_7Trident performance: 3608KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 1 time(s), Railgun_Quadruplet_7Trident performance: 3741KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 1 time(s), Railgun_Quadruplet_7Trident performance: 3741KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 1 time(s), Railgun_Quadruplet_7Trident performance: 3673KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), Railgun_Quadruplet_7Trident performance: 3961KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 0 time(s), Railgun_Quadruplet_7Trident performance: 3961KB/clock

Railgun_Quadruplet_7Trident 49 i.e. average performance: 3266KB/clock
Railgun_Quadruplet_7Trident 49 total Skip-Performance/Iterations: 2532816/6574958192

Found ('If you have read') 9 time(s), BNDM_64 performance: 1820KB/clock
Found ('you should have ') 181 time(s), BNDM_64 performance: 1888KB/clock
Found ('pretty good idea') 1 time(s), BNDM_64 performance: 2149KB/clock
Found ('Osho Books on CD') 4 time(s), BNDM_64 performance: 2104KB/clock
Found ('use you will put') 1 time(s), BNDM_64 performance: 1888KB/clock
Found ('to is up to you.') 1 time(s), BNDM_64 performance: 1836KB/clock
Found ('the largest ever') 1 time(s), BNDM_64 performance: 1804KB/clock
Found ('of understanding') 852 time(s), BNDM_64 performance: 2196KB/clock
Found ('and knowledge on') 1 time(s), BNDM_64 performance: 1942KB/clock
Found ('more, a complete') 1 time(s), BNDM_64 performance: 2020KB/clock
Found ('and a new way of') 5 time(s), BNDM_64 performance: 1924KB/clock
Found ('access to Osho's') 1 time(s), BNDM_64 performance: 2000KB/clock
Found ('words, ideas and') 1 time(s), BNDM_64 performance: 1961KB/clock
Found ('ideas and vision') 1 time(s), BNDM_64 performance: 1906KB/clock
Found ('and to make them') 6 time(s), BNDM_64 performance: 1697KB/clock
Found ('AGATTTTAAAGATTTT') 0 time(s), BNDM_64 performance: 4592KB/clock
Found ('TTGACATAGAATCTTA') 0 time(s), BNDM_64 performance: 4699KB/clock
Found ('TGGAGGCTGAGAAATA') 0 time(s), BNDM_64 performance: 4592KB/clock
Found ('fastest fox with biggest strides') 0 time(s), BNDM_64 performance: 3544KB/clock
Found ('you will put it to is up to you.') 1 time(s), BNDM_64 performance: 2971KB/clock
Found ('on meditation and its techniques') 1 time(s), BNDM_64 performance: 3259KB/clock
Found ('way of life. The purpose of this') 1 time(s), BNDM_64 performance: 3207KB/clock
Found ('ROM is to provide access to Osho') 1 time(s), BNDM_64 performance: 3259KB/clock
Found ('Osho's words, ideas and vision, ') 1 time(s), BNDM_64 performance: 3259KB/clock
Found ('and to make them available to as') 1 time(s), BNDM_64 performance: 3108KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 0 time(s), BNDM_64 performance: 5051KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), BNDM_64 performance: 5051KB/clock
Found ('you have read through the preceding chapters you') 1 time(s), BNDM_64 performance: 3673KB/clock
Found ('through the preceding chapters you should have a') 1 time(s), BNDM_64 performance: 3741KB/clock
Found ('preceding chapters you should have a pretty good') 1 time(s), BNDM_64 performance: 3885KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 1 time(s), BNDM_64 performance: 3741KB/clock
Found ('of understanding and knowledge on meditation and') 1 time(s), BNDM_64 performance: 3961KB/clock
Found ('much more, a complete, world view of the New Man') 1 time(s), BNDM_64 performance: 3885KB/clock
Found ('world view of the New Man and a new way of life.') 1 time(s), BNDM_64 performance: 3812KB/clock
Found ('is to provide access to Osho's words, ideas and ') 1 time(s), BNDM_64 performance: 3885KB/clock
Found ('provide access to Osho's words, ideas and vision') 1 time(s), BNDM_64 performance: 3961KB/clock
Found ('access to Osho's words, ideas and vision, and to') 1 time(s), BNDM_64 performance: 3885KB/clock
Found ('Osho's words, ideas and vision, and to make them') 1 time(s), BNDM_64 performance: 3741KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 0 time(s), BNDM_64 performance: 4699KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 0 time(s), BNDM_64 performance: 4699KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 1 time(s), BNDM_64 performance: 4123KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 1 time(s), BNDM_64 performance: 4123KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 1 time(s), BNDM_64 performance: 3961KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 1 time(s), BNDM_64 performance: 4209KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 1 time(s), BNDM_64 performance: 4299KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 1 time(s), BNDM_64 performance: 4209KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 1 time(s), BNDM_64 performance: 4123KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), BNDM_64 performance: 4928KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 0 time(s), BNDM_64 performance: 4810KB/clock

BNDM_64 49 i.e. average performance: 3017KB/clock
BNDM_64 49 total Skip-Performance/Iterations: 2779920/6213485968

Found ('If you have read') 9 time(s), Railgun_Quadruplet_7Elsiane performance: 1453KB/clock
Found ('you should have ') 181 time(s), Railgun_Quadruplet_7Elsiane performance: 1496KB/clock
Found ('pretty good idea') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1507KB/clock
Found ('Osho Books on CD') 4 time(s), Railgun_Quadruplet_7Elsiane performance: 1422KB/clock
Found ('use you will put') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1464KB/clock
Found ('to is up to you.') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1453KB/clock
Found ('the largest ever') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1413KB/clock
Found ('of understanding') 852 time(s), Railgun_Quadruplet_7Elsiane performance: 1629KB/clock
Found ('and knowledge on') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1383KB/clock
Found ('more, a complete') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1542KB/clock
Found ('and a new way of') 5 time(s), Railgun_Quadruplet_7Elsiane performance: 1393KB/clock
Found ('access to Osho's') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1542KB/clock
Found ('words, ideas and') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1393KB/clock
Found ('ideas and vision') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1519KB/clock
Found ('and to make them') 6 time(s), Railgun_Quadruplet_7Elsiane performance: 1433KB/clock
Found ('AGATTTTAAAGATTTT') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4209KB/clock
Found ('TTGACATAGAATCTTA') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4299KB/clock
Found ('TGGAGGCTGAGAAATA') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4209KB/clock
Found ('fastest fox with biggest strides') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 2296KB/clock
Found ('you will put it to is up to you.') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2322KB/clock
Found ('on meditation and its techniques') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2270KB/clock
Found ('way of life. The purpose of this') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2126KB/clock
Found ('ROM is to provide access to Osho') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2196KB/clock
Found ('Osho's words, ideas and vision, ') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2464KB/clock
Found ('and to make them available to as') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2104KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4810KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4699KB/clock
Found ('you have read through the preceding chapters you') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2220KB/clock
Found ('through the preceding chapters you should have a') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2296KB/clock
Found ('preceding chapters you should have a pretty good') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2590KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2886KB/clock
Found ('of understanding and knowledge on meditation and') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2694KB/clock
Found ('much more, a complete, world view of the New Man') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2557KB/clock
Found ('world view of the New Man and a new way of life.') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2845KB/clock
Found ('is to provide access to Osho's words, ideas and ') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2624KB/clock
Found ('provide access to Osho's words, ideas and vision') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2624KB/clock
Found ('access to Osho's words, ideas and vision, and to') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2557KB/clock
Found ('Osho's words, ideas and vision, and to make them') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2590KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4699KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4699KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2694KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3207KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2971KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3061KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2928KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 3015KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2845KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4699KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4699KB/clock

Railgun_Quadruplet_7Elsiane 49 i.e. average performance: 2245KB/clock
Railgun_Quadruplet_7Elsiane 49 total Skip-Performance/Iterations: 1880784/8251788448

Found ('If you have read') 9 time(s), Railgun_Quadruplet_7Hasherezade performance: 2349KB/clock
Found ('you should have ') 181 time(s), Railgun_Quadruplet_7Hasherezade performance: 2377KB/clock
Found ('pretty good idea') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2624KB/clock
Found ('Osho Books on CD') 4 time(s), Railgun_Quadruplet_7Hasherezade performance: 2557KB/clock
Found ('use you will put') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2464KB/clock
Found ('to is up to you.') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2377KB/clock
Found ('the largest ever') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2349KB/clock
Found ('of understanding') 852 time(s), Railgun_Quadruplet_7Hasherezade performance: 2525KB/clock
Found ('and knowledge on') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2434KB/clock
Found ('more, a complete') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2590KB/clock
Found ('and a new way of') 5 time(s), Railgun_Quadruplet_7Hasherezade performance: 2494KB/clock
Found ('access to Osho's') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2494KB/clock
Found ('words, ideas and') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2405KB/clock
Found ('ideas and vision') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2377KB/clock
Found ('and to make them') 6 time(s), Railgun_Quadruplet_7Hasherezade performance: 2149KB/clock
Found ('AGATTTTAAAGATTTT') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3108KB/clock
Found ('TTGACATAGAATCTTA') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3157KB/clock
Found ('TGGAGGCTGAGAAATA') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3157KB/clock
Found ('fastest fox with biggest strides') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3367KB/clock
Found ('you will put it to is up to you.') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3259KB/clock
Found ('on meditation and its techniques') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3259KB/clock
Found ('way of life. The purpose of this') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3207KB/clock
Found ('ROM is to provide access to Osho') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3312KB/clock
Found ('Osho's words, ideas and vision, ') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3259KB/clock
Found ('and to make them available to as') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3259KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3812KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3812KB/clock
Found ('you have read through the preceding chapters you') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3367KB/clock
Found ('through the preceding chapters you should have a') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3367KB/clock
Found ('preceding chapters you should have a pretty good') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3424KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3424KB/clock
Found ('of understanding and knowledge on meditation and') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3424KB/clock
Found ('much more, a complete, world view of the New Man') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3483KB/clock
Found ('world view of the New Man and a new way of life.') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3424KB/clock
Found ('is to provide access to Osho's words, ideas and ') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3424KB/clock
Found ('provide access to Osho's words, ideas and vision') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3424KB/clock
Found ('access to Osho's words, ideas and vision, and to') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3483KB/clock
Found ('Osho's words, ideas and vision, and to make them') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3367KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3885KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3885KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3483KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3483KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3483KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3544KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3483KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3483KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3483KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3961KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3961KB/clock

Railgun_Quadruplet_7Hasherezade 49 i.e. average performance: 3081KB/clock
Railgun_Quadruplet_7Hasherezade 49 total Skip-Performance/Iterations: 2701232/6466619104

3] hs_alt_HuRef_chr1.fa, Intel compiled:

Found ('If you have read') 0 time(s), Railgun_Quadruplet_7Trident performance: 3061KB/clock
Found ('you should have ') 0 time(s), Railgun_Quadruplet_7Trident performance: 3019KB/clock
Found ('pretty good idea') 0 time(s), Railgun_Quadruplet_7Trident performance: 3196KB/clock
Found ('Osho Books on CD') 0 time(s), Railgun_Quadruplet_7Trident performance: 3150KB/clock
Found ('use you will put') 0 time(s), Railgun_Quadruplet_7Trident performance: 3150KB/clock
Found ('to is up to you.') 0 time(s), Railgun_Quadruplet_7Trident performance: 3196KB/clock
Found ('the largest ever') 0 time(s), Railgun_Quadruplet_7Trident performance: 3150KB/clock
Found ('of understanding') 0 time(s), Railgun_Quadruplet_7Trident performance: 3150KB/clock
Found ('and knowledge on') 0 time(s), Railgun_Quadruplet_7Trident performance: 3196KB/clock
Found ('more, a complete') 0 time(s), Railgun_Quadruplet_7Trident performance: 3150KB/clock
Found ('and a new way of') 0 time(s), Railgun_Quadruplet_7Trident performance: 3196KB/clock
Found ('access to Osho's') 0 time(s), Railgun_Quadruplet_7Trident performance: 3150KB/clock
Found ('words, ideas and') 0 time(s), Railgun_Quadruplet_7Trident performance: 3150KB/clock
Found ('ideas and vision') 0 time(s), Railgun_Quadruplet_7Trident performance: 3196KB/clock
Found ('and to make them') 0 time(s), Railgun_Quadruplet_7Trident performance: 3150KB/clock
Found ('AGATTTTAAAGATTTT') 3 time(s), Railgun_Quadruplet_7Trident performance: 1317KB/clock
Found ('TTGACATAGAATCTTA') 1 time(s), Railgun_Quadruplet_7Trident performance: 1367KB/clock
Found ('TGGAGGCTGAGAAATA') 1 time(s), Railgun_Quadruplet_7Trident performance: 1201KB/clock
Found ('fastest fox with biggest strides') 0 time(s), Railgun_Quadruplet_7Trident performance: 3813KB/clock
Found ('you will put it to is up to you.') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('on meditation and its techniques') 0 time(s), Railgun_Quadruplet_7Trident performance: 3813KB/clock
Found ('way of life. The purpose of this') 0 time(s), Railgun_Quadruplet_7Trident performance: 3813KB/clock
Found ('ROM is to provide access to Osho') 0 time(s), Railgun_Quadruplet_7Trident performance: 3813KB/clock
Found ('Osho's words, ideas and vision, ') 0 time(s), Railgun_Quadruplet_7Trident performance: 3813KB/clock
Found ('and to make them available to as') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 1 time(s), Railgun_Quadruplet_7Trident performance: 2241KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), Railgun_Quadruplet_7Trident performance: 1994KB/clock
Found ('you have read through the preceding chapters you') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('through the preceding chapters you should have a') 0 time(s), Railgun_Quadruplet_7Trident performance: 3813KB/clock
Found ('preceding chapters you should have a pretty good') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('of understanding and knowledge on meditation and') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('much more, a complete, world view of the New Man') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('world view of the New Man and a new way of life.') 0 time(s), Railgun_Quadruplet_7Trident performance: 3813KB/clock
Found ('is to provide access to Osho's words, ideas and ') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('provide access to Osho's words, ideas and vision') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('access to Osho's words, ideas and vision, and to') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('Osho's words, ideas and vision, and to make them') 0 time(s), Railgun_Quadruplet_7Trident performance: 3813KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 1 time(s), Railgun_Quadruplet_7Trident performance: 1890KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 1 time(s), Railgun_Quadruplet_7Trident performance: 1842KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 0 time(s), Railgun_Quadruplet_7Trident performance: 4025KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 0 time(s), Railgun_Quadruplet_7Trident performance: 4025KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), Railgun_Quadruplet_7Trident performance: 2362KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 1 time(s), Railgun_Quadruplet_7Trident performance: 2498KB/clock

Railgun_Quadruplet_7Trident 49 i.e. average performance: 3016KB/clock
Railgun_Quadruplet_7Trident 49 total Skip-Performance/Iterations: 2479456/7653285440

Found ('If you have read') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('you should have ') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('pretty good idea') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('Osho Books on CD') 0 time(s), BNDM_64 performance: 3293KB/clock
Found ('use you will put') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('to is up to you.') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('the largest ever') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('of understanding') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('and knowledge on') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('more, a complete') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('and a new way of') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('access to Osho's') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('words, ideas and') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('ideas and vision') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('and to make them') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('AGATTTTAAAGATTTT') 3 time(s), BNDM_64 performance: 1187KB/clock
Found ('TTGACATAGAATCTTA') 1 time(s), BNDM_64 performance: 1271KB/clock
Found ('TGGAGGCTGAGAAATA') 1 time(s), BNDM_64 performance: 1181KB/clock
Found ('fastest fox with biggest strides') 0 time(s), BNDM_64 performance: 5176KB/clock
Found ('you will put it to is up to you.') 0 time(s), BNDM_64 performance: 5055KB/clock
Found ('on meditation and its techniques') 0 time(s), BNDM_64 performance: 5055KB/clock
Found ('way of life. The purpose of this') 0 time(s), BNDM_64 performance: 4262KB/clock
Found ('ROM is to provide access to Osho') 0 time(s), BNDM_64 performance: 5055KB/clock
Found ('Osho's words, ideas and vision, ') 0 time(s), BNDM_64 performance: 5176KB/clock
Found ('and to make them available to as') 0 time(s), BNDM_64 performance: 5176KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 1 time(s), BNDM_64 performance: 2152KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), BNDM_64 performance: 2070KB/clock
Found ('you have read through the preceding chapters you') 0 time(s), BNDM_64 performance: 4830KB/clock
Found ('through the preceding chapters you should have a') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('preceding chapters you should have a pretty good') 0 time(s), BNDM_64 performance: 4830KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 0 time(s), BNDM_64 performance: 4347KB/clock
Found ('of understanding and knowledge on meditation and') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('much more, a complete, world view of the New Man') 0 time(s), BNDM_64 performance: 4830KB/clock
Found ('world view of the New Man and a new way of life.') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('is to provide access to Osho's words, ideas and ') 0 time(s), BNDM_64 performance: 4830KB/clock
Found ('provide access to Osho's words, ideas and vision') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('access to Osho's words, ideas and vision, and to') 0 time(s), BNDM_64 performance: 4830KB/clock
Found ('Osho's words, ideas and vision, and to make them') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 1 time(s), BNDM_64 performance: 2937KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 1 time(s), BNDM_64 performance: 2898KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 0 time(s), BNDM_64 performance: 5055KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 0 time(s), BNDM_64 performance: 4436KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 0 time(s), BNDM_64 performance: 4940KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 0 time(s), BNDM_64 performance: 4940KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 0 time(s), BNDM_64 performance: 4940KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 0 time(s), BNDM_64 performance: 4940KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 0 time(s), BNDM_64 performance: 4940KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), BNDM_64 performance: 3506KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 1 time(s), BNDM_64 performance: 3506KB/clock

BNDM_64 49 i.e. average performance: 3761KB/clock
BNDM_64 49 total Skip-Performance/Iterations: 2806144/6595760528

Found ('If you have read') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('you should have ') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('pretty good idea') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('Osho Books on CD') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 2288KB/clock
Found ('use you will put') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('to is up to you.') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('the largest ever') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('of understanding') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('and knowledge on') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4625KB/clock
Found ('more, a complete') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('and a new way of') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('access to Osho's') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('words, ideas and') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('ideas and vision') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('and to make them') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('AGATTTTAAAGATTTT') 3 time(s), Railgun_Quadruplet_7Elsiane performance: 1449KB/clock
Found ('TTGACATAGAATCTTA') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 983KB/clock
Found ('TGGAGGCTGAGAAATA') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1086KB/clock
Found ('fastest fox with biggest strides') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('you will put it to is up to you.') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('on meditation and its techniques') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('way of life. The purpose of this') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 3293KB/clock
Found ('ROM is to provide access to Osho') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('Osho's words, ideas and vision, ') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('and to make them available to as') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 869KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2070KB/clock
Found ('you have read through the preceding chapters you') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5176KB/clock
Found ('through the preceding chapters you should have a') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5176KB/clock
Found ('preceding chapters you should have a pretty good') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5176KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4025KB/clock
Found ('of understanding and knowledge on meditation and') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('much more, a complete, world view of the New Man') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('world view of the New Man and a new way of life.') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5176KB/clock
Found ('is to provide access to Osho's words, ideas and ') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('provide access to Osho's words, ideas and vision') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('access to Osho's words, ideas and vision, and to') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5176KB/clock
Found ('Osho's words, ideas and vision, and to make them') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1150KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1294KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 3952KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 2218KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1890KB/clock

Railgun_Quadruplet_7Elsiane 49 i.e. average performance: 3164KB/clock
Railgun_Quadruplet_7Elsiane 49 total Skip-Performance/Iterations: 2540592/9256480624

Found ('If you have read') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2683KB/clock
Found ('you should have ') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2619KB/clock
Found ('pretty good idea') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2651KB/clock
Found ('Osho Books on CD') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2651KB/clock
Found ('use you will put') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2651KB/clock
Found ('to is up to you.') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2651KB/clock
Found ('the largest ever') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2619KB/clock
Found ('of understanding') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2683KB/clock
Found ('and knowledge on') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2619KB/clock
Found ('more, a complete') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2651KB/clock
Found ('and a new way of') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2651KB/clock
Found ('access to Osho's') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2651KB/clock
Found ('words, ideas and') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2651KB/clock
Found ('ideas and vision') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2619KB/clock
Found ('and to make them') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 2683KB/clock
Found ('AGATTTTAAAGATTTT') 3 time(s), Railgun_Quadruplet_7Hasherezade performance: 1050KB/clock
Found ('TTGACATAGAATCTTA') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 890KB/clock
Found ('TGGAGGCTGAGAAATA') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 970KB/clock
Found ('fastest fox with biggest strides') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3748KB/clock
Found ('you will put it to is up to you.') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3748KB/clock
Found ('on meditation and its techniques') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('way of life. The purpose of this') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3748KB/clock
Found ('ROM is to provide access to Osho') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('Osho's words, ideas and vision, ') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3748KB/clock
Found ('and to make them available to as') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3748KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2090KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 1994KB/clock
Found ('you have read through the preceding chapters you') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('through the preceding chapters you should have a') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('preceding chapters you should have a pretty good') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('of understanding and knowledge on meditation and') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('much more, a complete, world view of the New Man') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('world view of the New Man and a new way of life.') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('is to provide access to Osho's words, ideas and ') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('provide access to Osho's words, ideas and vision') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('access to Osho's words, ideas and vision, and to') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('Osho's words, ideas and vision, and to make them') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3105KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3019KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3952KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3952KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3952KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3952KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3952KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3952KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3952KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3563KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3623KB/clock

Railgun_Quadruplet_7Hasherezade 49 i.e. average performance: 2827KB/clock
Railgun_Quadruplet_7Hasherezade 49 total Skip-Performance/Iterations: 2691888/7089590528

4] hs_alt_HuRef_chr1.fa, Microsoft compiled:

Found ('If you have read') 0 time(s), Railgun_Quadruplet_7Trident performance: 3344KB/clock
Found ('you should have ') 0 time(s), Railgun_Quadruplet_7Trident performance: 3293KB/clock
Found ('pretty good idea') 0 time(s), Railgun_Quadruplet_7Trident performance: 3344KB/clock
Found ('Osho Books on CD') 0 time(s), Railgun_Quadruplet_7Trident performance: 3344KB/clock
Found ('use you will put') 0 time(s), Railgun_Quadruplet_7Trident performance: 3344KB/clock
Found ('to is up to you.') 0 time(s), Railgun_Quadruplet_7Trident performance: 3344KB/clock
Found ('the largest ever') 0 time(s), Railgun_Quadruplet_7Trident performance: 3293KB/clock
Found ('of understanding') 0 time(s), Railgun_Quadruplet_7Trident performance: 3344KB/clock
Found ('and knowledge on') 0 time(s), Railgun_Quadruplet_7Trident performance: 3344KB/clock
Found ('more, a complete') 0 time(s), Railgun_Quadruplet_7Trident performance: 3019KB/clock
Found ('and a new way of') 0 time(s), Railgun_Quadruplet_7Trident performance: 3344KB/clock
Found ('access to Osho's') 0 time(s), Railgun_Quadruplet_7Trident performance: 3344KB/clock
Found ('words, ideas and') 0 time(s), Railgun_Quadruplet_7Trident performance: 3344KB/clock
Found ('ideas and vision') 0 time(s), Railgun_Quadruplet_7Trident performance: 3344KB/clock
Found ('and to make them') 0 time(s), Railgun_Quadruplet_7Trident performance: 3344KB/clock
Found ('AGATTTTAAAGATTTT') 3 time(s), Railgun_Quadruplet_7Trident performance: 1301KB/clock
Found ('TTGACATAGAATCTTA') 1 time(s), Railgun_Quadruplet_7Trident performance: 1350KB/clock
Found ('TGGAGGCTGAGAAATA') 1 time(s), Railgun_Quadruplet_7Trident performance: 1181KB/clock
Found ('fastest fox with biggest strides') 0 time(s), Railgun_Quadruplet_7Trident performance: 3813KB/clock
Found ('you will put it to is up to you.') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('on meditation and its techniques') 0 time(s), Railgun_Quadruplet_7Trident performance: 3813KB/clock
Found ('way of life. The purpose of this') 0 time(s), Railgun_Quadruplet_7Trident performance: 3813KB/clock
Found ('ROM is to provide access to Osho') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('Osho's words, ideas and vision, ') 0 time(s), Railgun_Quadruplet_7Trident performance: 3813KB/clock
Found ('and to make them available to as') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 1 time(s), Railgun_Quadruplet_7Trident performance: 2218KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), Railgun_Quadruplet_7Trident performance: 1976KB/clock
Found ('you have read through the preceding chapters you') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('through the preceding chapters you should have a') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('preceding chapters you should have a pretty good') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('of understanding and knowledge on meditation and') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('much more, a complete, world view of the New Man') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('world view of the New Man and a new way of life.') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('is to provide access to Osho's words, ideas and ') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('provide access to Osho's words, ideas and vision') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('access to Osho's words, ideas and vision, and to') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('Osho's words, ideas and vision, and to make them') 0 time(s), Railgun_Quadruplet_7Trident performance: 3882KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 1 time(s), Railgun_Quadruplet_7Trident performance: 1923KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 1 time(s), Railgun_Quadruplet_7Trident performance: 1874KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 0 time(s), Railgun_Quadruplet_7Trident performance: 4025KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 0 time(s), Railgun_Quadruplet_7Trident performance: 4025KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 0 time(s), Railgun_Quadruplet_7Trident performance: 3952KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), Railgun_Quadruplet_7Trident performance: 2415KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 1 time(s), Railgun_Quadruplet_7Trident performance: 2527KB/clock

Railgun_Quadruplet_7Trident 49 i.e. average performance: 3064KB/clock
Railgun_Quadruplet_7Trident 49 total Skip-Performance/Iterations: 2479456/7653285440

Found ('If you have read') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('you should have ') 0 time(s), BNDM_64 performance: 4830KB/clock
Found ('pretty good idea') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('Osho Books on CD') 0 time(s), BNDM_64 performance: 3396KB/clock
Found ('use you will put') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('to is up to you.') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('the largest ever') 0 time(s), BNDM_64 performance: 4830KB/clock
Found ('of understanding') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('and knowledge on') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('more, a complete') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('and a new way of') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('access to Osho's') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('words, ideas and') 0 time(s), BNDM_64 performance: 4830KB/clock
Found ('ideas and vision') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('and to make them') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('AGATTTTAAAGATTTT') 3 time(s), BNDM_64 performance: 1175KB/clock
Found ('TTGACATAGAATCTTA') 1 time(s), BNDM_64 performance: 1228KB/clock
Found ('TGGAGGCTGAGAAATA') 1 time(s), BNDM_64 performance: 1156KB/clock
Found ('fastest fox with biggest strides') 0 time(s), BNDM_64 performance: 5055KB/clock
Found ('you will put it to is up to you.') 0 time(s), BNDM_64 performance: 5055KB/clock
Found ('on meditation and its techniques') 0 time(s), BNDM_64 performance: 5176KB/clock
Found ('way of life. The purpose of this') 0 time(s), BNDM_64 performance: 4180KB/clock
Found ('ROM is to provide access to Osho') 0 time(s), BNDM_64 performance: 5055KB/clock
Found ('Osho's words, ideas and vision, ') 0 time(s), BNDM_64 performance: 5055KB/clock
Found ('and to make them available to as') 0 time(s), BNDM_64 performance: 5055KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 1 time(s), BNDM_64 performance: 2131KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), BNDM_64 performance: 2012KB/clock
Found ('you have read through the preceding chapters you') 0 time(s), BNDM_64 performance: 4830KB/clock
Found ('through the preceding chapters you should have a') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('preceding chapters you should have a pretty good') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 0 time(s), BNDM_64 performance: 4347KB/clock
Found ('of understanding and knowledge on meditation and') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('much more, a complete, world view of the New Man') 0 time(s), BNDM_64 performance: 4830KB/clock
Found ('world view of the New Man and a new way of life.') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('is to provide access to Osho's words, ideas and ') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('provide access to Osho's words, ideas and vision') 0 time(s), BNDM_64 performance: 4830KB/clock
Found ('access to Osho's words, ideas and vision, and to') 0 time(s), BNDM_64 performance: 4725KB/clock
Found ('Osho's words, ideas and vision, and to make them') 0 time(s), BNDM_64 performance: 4830KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 1 time(s), BNDM_64 performance: 2860KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 1 time(s), BNDM_64 performance: 2860KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 0 time(s), BNDM_64 performance: 4940KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 0 time(s), BNDM_64 performance: 4529KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 0 time(s), BNDM_64 performance: 4940KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 0 time(s), BNDM_64 performance: 4940KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 0 time(s), BNDM_64 performance: 4940KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 0 time(s), BNDM_64 performance: 4940KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 0 time(s), BNDM_64 performance: 4940KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), BNDM_64 performance: 3450KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 1 time(s), BNDM_64 performance: 3450KB/clock

BNDM_64 49 i.e. average performance: 3735KB/clock
BNDM_64 49 total Skip-Performance/Iterations: 2806144/6595760528

Found ('If you have read') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('you should have ') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('pretty good idea') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4436KB/clock
Found ('Osho Books on CD') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 2031KB/clock
Found ('use you will put') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('to is up to you.') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4436KB/clock
Found ('the largest ever') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('of understanding') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('and knowledge on') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('more, a complete') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('and a new way of') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('access to Osho's') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4436KB/clock
Found ('words, ideas and') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('ideas and vision') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4436KB/clock
Found ('and to make them') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('AGATTTTAAAGATTTT') 3 time(s), Railgun_Quadruplet_7Elsiane performance: 1070KB/clock
Found ('TTGACATAGAATCTTA') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 724KB/clock
Found ('TGGAGGCTGAGAAATA') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 776KB/clock
Found ('fastest fox with biggest strides') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('you will put it to is up to you.') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('on meditation and its techniques') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('way of life. The purpose of this') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 2977KB/clock
Found ('ROM is to provide access to Osho') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('Osho's words, ideas and vision, ') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('and to make them available to as') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 5055KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 619KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1530KB/clock
Found ('you have read through the preceding chapters you') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('through the preceding chapters you should have a') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('preceding chapters you should have a pretty good') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4529KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 3813KB/clock
Found ('of understanding and knowledge on meditation and') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4830KB/clock
Found ('much more, a complete, world view of the New Man') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4830KB/clock
Found ('world view of the New Man and a new way of life.') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('is to provide access to Osho's words, ideas and ') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4830KB/clock
Found ('provide access to Osho's words, ideas and vision') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4830KB/clock
Found ('access to Osho's words, ideas and vision, and to') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('Osho's words, ideas and vision, and to make them') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4940KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 902KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 921KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4725KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 3813KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4725KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4830KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4725KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4725KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 0 time(s), Railgun_Quadruplet_7Elsiane performance: 4725KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1622KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 1 time(s), Railgun_Quadruplet_7Elsiane performance: 1430KB/clock

Railgun_Quadruplet_7Elsiane 49 i.e. average performance: 2679KB/clock
Railgun_Quadruplet_7Elsiane 49 total Skip-Performance/Iterations: 2540592/9256480624

Found ('If you have read') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3196KB/clock
Found ('you should have ') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3196KB/clock
Found ('pretty good idea') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3150KB/clock
Found ('Osho Books on CD') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3196KB/clock
Found ('use you will put') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3196KB/clock
Found ('to is up to you.') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3196KB/clock
Found ('the largest ever') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3150KB/clock
Found ('of understanding') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3196KB/clock
Found ('and knowledge on') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3196KB/clock
Found ('more, a complete') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3196KB/clock
Found ('and a new way of') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3150KB/clock
Found ('access to Osho's') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3196KB/clock
Found ('words, ideas and') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3196KB/clock
Found ('ideas and vision') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3196KB/clock
Found ('and to make them') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3150KB/clock
Found ('AGATTTTAAAGATTTT') 3 time(s), Railgun_Quadruplet_7Hasherezade performance: 1109KB/clock
Found ('TTGACATAGAATCTTA') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 866KB/clock
Found ('TGGAGGCTGAGAAATA') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 949KB/clock
Found ('fastest fox with biggest strides') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('you will put it to is up to you.') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('on meditation and its techniques') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('way of life. The purpose of this') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('ROM is to provide access to Osho') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('Osho's words, ideas and vision, ') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('and to make them available to as') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATA') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2050KB/clock
Found ('GAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 1958KB/clock
Found ('you have read through the preceding chapters you') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('through the preceding chapters you should have a') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('preceding chapters you should have a pretty good') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('CD-ROM. What use you will put it to is up to you') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3813KB/clock
Found ('of understanding and knowledge on meditation and') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('much more, a complete, world view of the New Man') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('world view of the New Man and a new way of life.') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('is to provide access to Osho's words, ideas and ') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('provide access to Osho's words, ideas and vision') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('access to Osho's words, ideas and vision, and to') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('Osho's words, ideas and vision, and to make them') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3882KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCT') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2977KB/clock
Found ('TAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAA') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 2937KB/clock
Found ('the preceding chapters you should have a pretty good idea on how') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 4025KB/clock
Found ('Books on CD-ROM. What use you will put it to is up to you. It is') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3952KB/clock
Found ('What use you will put it to is up to you. It is the largest ever') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 4025KB/clock
Found ('repository of understanding and knowledge on meditation and its ') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3952KB/clock
Found ('of understanding and knowledge on meditation and its techniques.') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 4025KB/clock
Found ('to provide access to Osho's words, ideas and vision, and to make') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3952KB/clock
Found ('to Osho's words, ideas and vision, and to make them available to') 0 time(s), Railgun_Quadruplet_7Hasherezade performance: 3952KB/clock
Found ('AGATTTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTT') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3506KB/clock
Found ('TTTAAAGATTTTCTTTTTTTTTGACATAGAATCTTATGGAGGCTGAGAAATAATTTTTTTTCTA') 1 time(s), Railgun_Quadruplet_7Hasherezade performance: 3623KB/clock

Railgun_Quadruplet_7Hasherezade 49 i.e. average performance: 2997KB/clock
Railgun_Quadruplet_7Hasherezade 49 total Skip-Performance/Iterations: 2691888/7089590528

This dump comes in handy - it shows some major weak points.
To run the same test see 'Download section' further below:
Mimino

Download section:

I want more people to experience the strstr-benchmark-fun, also to offer a playground/base for further improvements, so here is my newest (2012-Feb-29) 64bit test package:

KAZE_Trident_vs_BNDM_64_vs_Elsiane_vs_Hasherezade.txt 796 bytes
KAZE_Trident_vs_BNDM_64_vs_Elsiane_vs_Hasherezade.zip 126,074,306 bytes

And the "old" packages:

_KAZE_strstr_SHORT-SHOWDOWN_7Gulliver_7sun_vs_7_vs_7sunhorse_vs_7deuce_vs_BMF.7z 40,600,398 bytes
_KAZE_Simplicius_Simplicissimus_Septupleton_r2-_strstr_SHORT-SHOWDOWN_r7.7z 60,153,515 bytes

Mimino - Georgian word for hawk.
I see 'Mimino' as a nifty mix of 'Doublet' & 'Trident' & 'BNDM_64' & 'Elsiane' & 'Hasherezade'.


Mimino

Note1: My wish is Railgun_r8_Mimino_x64 to become the fastest pattern searcher with help of more experienced C programmers, each creative suggestion will be added here gladly.

Note2: Obviously the function needs tuning since it must perform even better(see the dump above), on i3[+] I expect significant speed up, for AMD it is to be seen.

Note3: An article came to being at http://www.codeproject.com/KB/cpp/Railgun_Quadruplet.aspx, thanks a lot.


Jester

Copyleft Copyleft Sanmayce, 2010 Dec 22; Last revision: 2012 Feb 29; for contacts: sanmayce@sanmayce.com